
	Where results make sense

Topic: 1051 Merope

	Update for (1051) Merope - February 2, 2002
		In the evening of February 2, 2002 a faint 11.0 mag star TYC 4742-00609-1 will be occulted by a 69 km asteroid (1051) Merope.
		This update is based on USNO/Flagstaff and OFXB astrometry for the asteroid and UCAC star position.
		Data for the event: * UT date and time of least geocentric approach: 20:30.4 UT * approx.
	mpocc.astro.cz /updates/2002/0202mer.html (402 words)

	Weekly Report 04/04/01 - 04/06/01 (Site not responding. Last check: 2007-10-10)
		REPORT SUBMITTED BY: WILL A. Since this is the first report that I have submitted thus far, I thought I would give a brief outline of what I have done on the project so far, as it pertains to the Thermal Subsystem.
		It was developed to solve the equations of motion for the libration (oscillation about equilibrium) of the satellite as it moves through its orbit.
		As far as the bitstream decoding, code was started to take the bitstream from MEROPE and decode it into human-readable data.
	www.ssel.montana.edu /merope/news/report040401.html (1365 words)

	[No title]
		IC 243, found the same night, and less than 3 arcmin to the northeast, is well-measured with respect to the same comparison star, so there is no possibility of a mistaken comparison star for IC 242.
		If Javelle saw the star with even the slightest haze, he could well have thought that it was the real NGC 1051, since it is considerably brighter than the galaxy.
		The bright glare around Merope is so intense that IC 349 is difficult to photograph.
	cdsweb.u-strasbg.fr /ftp/cats/VII/239A/icnotes.txt (23879 words)

	[No title] (Site not responding. Last check: 2007-10-10)
		However, reading Barnard's careful observations of the Pleiades in AN 3018 (where he announces the discovery of IC 349), it became clear that the IC object is actually a brighter knot in the larger Merope nebula, and very close to the star itself.
		This striation is a defect on the red plate, apparently caused by imperfections or reflections in the red Plexiglass filter.) It is just possible that this may be another case like IC 349 (which see) which is so close to Merope as to be not easily imaged.
		Until Eps Ori is imaged in such a way that the star can be removed to show the nebulosity that the Herschels and Dreyer claimed to have seen, I have no choice but to call NGC 1990 an illusion.
	www.ngcic.org /corwin/DataFiles/Nov19_2004/ngcnotes_1.txt (13799 words)

	Asteroidal Occultation Updates to April 30, 2003
		April 24, Andersen: The star is SAO 188005 = HIP 95124, spec.
		April 28, Merope: The star is SAO 117258 = TYC 0221-00894-1.
		April 28, Piccolo: The star is SAO 119364 = HIP 60378, spec.
	iota.jhuapl.edu /mp330.htm (810 words)

	Lecture 31
		Lecture 31: God/hero antagonism in the Oedipus Tyrannos
		My father was Polybos of Corinth, 775 my mother the Dorian Merope.
		I was considered the greatest man among the townspeople there, until a chance befell me, worthy of wonder, though not worthy of my own haste regarding it.
	www.uh.edu /~cldue/3307/2001/lecture31.html (1070 words)

	Oedipus Screens
		Oedipus should still be worrying about the murderer of Laius — but the death of Polybus (of natural causes) has made him think about the second part of the oracle.
		He will never return to Corinth while Merope (whom he still thinks is his mother) is alive.
		He still fears the second part of the prophecy - that he will sleep with his mother.
	direct.vtheatre.net /doc/oed-screen.html (2414 words)

	A.L.P.O. MINOR PLANETS SECTION
		While I could blame chads (USA joke) lets just say more observations needed in 2001 to resolve this magnitude problem.
		1051 Merope 00-08-08.07292 Amv 13.5 14.0 B/0.5 Lawrence Garrett Till next time Lawrence Garrett ****************************************************************** MAP Alert #49, November 23,2000 Thanksgivings Day Greetings MAP Observers!
		A short alert this USA holiday with word from Roger Harvey asteroids in suspected magnitude error.
	www.lpl.arizona.edu /~rhill/alpo/minplan/mapalert.html (2477 words)

	Update for (1051) Merope - February 2, 2002
		Update computed by Jan Manek; issued 27 Jan 2002 15:30:00 +0100 (CET)
		IOTA/IOTA-ES occultation update for (1051) Merope / TYC 4742-00609-1 on February 2, 2002 visible from N Italy, Austria, Czechia, Poland, W Lithuania, W Latvia, Estonia, NW Russia Summary
		Data for the minor planet: * general information: number, name: (1051) Merope approx.
	sorry.vse.cz /~ludek/mp/updates/2002/0202mer.html (402 words)

	BLAST Search Results (Site not responding. Last check: 2007-10-10)
		98 3e-17 gbAF436594.1AF436594 Merope tuber elongation factor-1 alp...
		Sbjct: 117 tacttaggggtctcgaatttccacagggtgatatctatggtgataccacgttcacgttct 58 Query: 1303 gccttcagtttatccaatacccaagcatatttgaaagaacctttacccatctc 1355
		>gbAF288068.1AF288068 Microstomum lineare elongation factor 1-a (ef1a) gene, partial cds Length = 1051 Score = 165 bits (83), Expect = 2e-37 Identities = 284/351 (80%) Strand = Plus / Minus Query: 1071 tgtgtatgccagcaatgcatgttctcttgtctgaccgtttttggaaataccagcttcaaa 1130
	www.icb.ufmg.br /~lgb/schisto/blastNT/Contig794.htm (2484 words)

	On-line Library - presented by the maker of Print Screen Capture software , Rapid Application Development, Session ... (Site not responding. Last check: 2007-10-10)
		Two Bishops magnanimously refused; but one was found with ambitious stupidity enough: Voltaire, for the third time, failed in this small matter, to him great.
		Nay, in spite of that kiss in MEROPE, he could not get his MORT DE CESAR acted; cabals rising; ANCIEN de Mirepoix rising; Orthodoxy, sour Opacity prevailing again.
		To Madame and him (though finely caressed in the Parisian circles) these were provoking months;--enough to make a man forswear Literature, and try some other Jacob's-Ladder in this world.
	library.floresca.net /473-3.html (14567 words)

Try your search on: Qwika (all wikis)