Where results make sense

About us   |   Why use us?   |   Reviews   |   PR   |   Contact us

Amaranth - Wikipedia, the free encyclopedia The amaranths (also called pigweeds) comprise the genus Amaranthus, a widely distributed genus of short-lived herbs, occurring mostly in temperate and tropical regions. Amaranthus albus (White Pigweed, Prostrate Pigweed, Pigweed Amaranth) Amaranthus blitoides (Mat Amaranth, Prostrate Amaranth, Prostrate Pigweed) en.wikipedia.org /wiki/Amaranth   (974 words)

Amaranthus Amaranthus albus : Tumbleweed, White Pigweed, Prostrate Pigweed, Pigweed Amaranth, White Amaranth. Amaranthus blitoides : Mat Amaranth, Prostrate Amaranth, Prostrate Pigweed. Amaranthus lividus (synonym) (= Amaranthus blitum): Purple Amaranth. www.aaaah.org /wiki/en/am/Amaranthus.htm   (172 words)

amaranthus   (Site not responding. Last check: 2007-08-09) Amaranthus (common name : pigweed) is a widely distributed genus of annual, short-living herbs, occurring mostly in temperate and tropical regions, belonging to the amaranth family (Amaranthaceae). Amaranthus hybridus : Smooth Amaranth, Slim Amaranth, Spleen Amaranth, Green Amaranth, Green Pigweed, Smooth Pigweed, Red Amaranth, Wild Beet. Amaranthus powelii : Green Amaranth, Powell Amaranth, Powell Pigweed. www.yourencyclopedia.net /amaranthus.html   (224 words)

Reference.com/Encyclopedia/Amaranth In legend, Amarynthus (a form of Amarantus) was a hunter of Artemis and king of Euboea; in a village of Amarynthus, of which he was the eponymous hero, there was a famous temple of Artemis Amarynthia or Amarysia (Strabo x. White Pigweed, Prostrate Pigweed, Pigweed Amaranth, and White Amaranth, Amaranthus albus Amaranthus graecizans (not accepted) = Amaranthus albus Prostrate Amaranth, Prostrate Pigweed. www.reference.com /browse/wiki/Amaranth   (790 words)

Amaranthus in Flora of North America @ efloras.org Morphologic terminology in Amaranthus, as used in different floristic and taxonomic treatments, is rather confusing, especially regarding the terms applied to inflorescences and flowers. The degree and scope of hybridization in Amaranthus are often overestimated, especially by European authors, and some taxa described as putative hybrids are in fact nonhybrid infraspecific forms of morphologically variable species. Species of Amaranthus were widely used by prehistoric and modern Native Americans as food, forage for livestock, medicinal plants, and, occasionally, for some other uses, such as face and body paint, ceremonial items, and fuel (S. Cheatham et al. www.efloras.org /florataxon.aspx?flora_id=1&taxon_id=101257   (2213 words)

BLAST Search Results Pinus Koraiensis chloroplast, complete genome 485 e-134 dbjD17510.1PINCPTRPG Pinus thunbergii chloroplast DNA, co... Amaranthus hypochondriacus 23S ribosomal RNA gene, complete sequence; chloroplast gene for chloroplast product Length = 2899 Score = 483 bits (251), Expect = e-133 Identities = 306/332 (92%), Gaps = 2/332 (0%) Strand = Plus / Plus Query: 9 ctggacagaaagaccctatgaagctttactgttccctgggattggctttgggcctttcct 68 Amaranthus hybridus 23S ribosomal RNA gene, complete sequence; chloroplast gene for chloroplast product Length = 2927 Score = 452 bits (235), Expect = e-124 Identities = 307/334 (91%), Gaps = 5/334 (1%) Strand = Plus / Plus Query: 9 ctggacagaaagaccctatgaagctttactgttccctgggattggctttgggcctttcct 68 www.genomics.purdue.edu /~jxu/JBC/blast/JBC-2_1_F11_T3.nt.blastn.html   (4567 words)

NatureServe Explorer Species Index: Genus Amaranthus AZ, CA, NM, NV, TX, UT Amaranthus fimbriatus var. The species is present in the nation or subnation due to direct or indirect human intervention. Your comments will be very valuable in improving the overall quality of our databases for the benefit of all users. natureserve.org /explorer/speciesIndex/Genus_Amaranthus_108791_1.htm   (1048 words)

Hiking Port Elizabeth Although the railroad tracks have only been abandoned for about five years, the tracks were covered with pine trees. In fact, there are lots of pine species in the area, including Pinus echinata (shortleaf pine), P. rigida (pitch pine), P. serotina (pond pine), P. taeda (loblolly pine), P. thunbergii (Japanese fl pine), and P. virginiana (Virginia pine). At times it was very tough going for the group as we had literally to push through the vegetation. nynjctbotany.org /njoptofc/porteliz.html   (454 words)

Department of Pharmacy(University of Zimbabwe)   (Site not responding. Last check: 2007-08-09) Reverse Phase High Pressure Chromatography (RP- HPLC) was useful in the preliminary studies to the determination of vitamin A as - carotene, its precursor form. Amaranthus thunbergii (mowa) had high concentration of Ca (0.3469 +/- 0.6171%), Fe (0.0332+/- 0.9278%) and Mg (0.2707 +/- 1.969%); (Cleome gynandra nyevhe) had 0,0075 +/- 0,7329% Zn and the pumpkin (Cucurbita spp) flower had 0,0007 +/- 176,6 % of the otherwise difficult/deficient Selenium (Se). Medicago sativa is a promising source of the vitamin and the results obtained in the preliminary determination of vitamin A show the reliability of the analytical method for the intended further analysis. www.uz.ac.zw /medicine/pharmacy/pubs/19992.html   (2858 words)

Plant Profile for Amaranthus thunbergii (Thunberg's amaranthus) | USDA PLANTS   (Site not responding. Last check: 2007-08-09) Plant Profile for Amaranthus thunbergii (Thunberg's amaranthus) See all the Amaranthus thumbnails at the PLANTS Gallery See county distributions for the following states by clicking on them below or on the map. plants.usda.gov /java/profile?symbol=AMTH2&mode=Print   (164 words)

BONAP Distribution Data: taxa of genus Amaranthus in the US   (Site not responding. Last check: 2007-08-09) BONAP Distribution Data: taxa of genus Amaranthus in the US Genus Amaranthus is a member of the Dicots group, subclass Caryophyllidae, order Caryophyllales, family Amaranthaceae. Amaranthus fimbriatus (checklist entry) (species map) (infras map) www.csdl.tamu.edu /FLORA/cgi/b98_list?genus=Amaranthus   (33 words)

Amaranthus [ Amaralia ] [ Amaranthus ] [ Amarcrinum ] Vernacular names of plants within the Genus Amaranthus For a description of the methodology followed in establishing this hierarchy see the note Nomenclature used in The Compleat Botanica. www.crescentbloom.com /plants/Genus/A/m/Amaranthus.htm   (101 words)

NatureServe Explorer Species Index: Genus Amaranthus AL, FL, LA, MS, NC, TN, TX, VA Amaranthus bigelovii AB, BC, MB, ON, QC, SK Amaranthus blitum AL, AZ, FL, NM, PA, SC, TX Amaranthus crispus www.natureserve.org /explorer/speciesIndex/Genus_Amaranthus_108791_1.htm   (1048 words)

117ombidi results   (Site not responding. Last check: 2007-08-09) The introduced vegetable species were generally difficult to grow due to the many pests and they also required lots of irrigation water. Five plots of 1m x 5m were sown with Ombidi (Cleome gynandra), Ekwakwa (Amaranthus thunbergii), Eshilalodi, Omundjulu (Sesuvium sesuvioides) and Ombudje (Sesbania pachycarpa) respectively. Seed had been collected locally earlier in the year and were just kept dry until sowing. hjem.get2net.dk /arne_larsen1/ombidi/117ombidiresults.html   (3406 words)

TNC Invasive Species Initiative page Amaranthus,graecizans, Amaranthus blitoides,Prostrate pigweed,,,,optimum germ temp 30-37C with periodic illumination and partial or entire removal of seed coat,,Germination and Establishment of Weeds for Experimental Purposes Amaranthus,viridis,,"green amaranth, prince of wales feather, green pigweed, ",,,,Amaranthus viridis is in 50 crops in more than 80 countries.,,WORLD WEEDS Natural Histories and Distribution - Holm et. Amaranthus,hybridus, Amaranthus hypochondriacus,Smooth pigweed,,,,seeds kept moist at 3C for 1-3wks gave high germ % at alternating temps 20-30C with or without light,,Germination and Establishment of Weeds for Experimental Purposes tncweeds.ucdavis.edu /global/australia/aca.html   (9126 words)

The Global Compendium of Weeds: Amaranthus thunbergii Moq.   (Site not responding. Last check: 2007-08-09) The Global Compendium of Weeds: Amaranthus thunbergii Moq. Common name(s): cape pigweed, pigweed, poor man's spinach, red pigweed, small pigweed, ape pigweed, ekuaka, ekwakwa, elopa, hanekam, kalkoenslurp, red devil, rooiduiwel, Thunberg's amaranthus, mohwa NOTE: for now (until database/website are updated), you must manually search for each data source in the GWC Data Sources document.) www.hear.org /gcw/html/autogend/species/1304.HTM   (138 words)

Baby's Breath: Information on Humidifiers   (Site not responding. Last check: 2007-08-09) Spiraea thunbergii Family: Rosaceae (rose family) Common Names: baby's breath spirea, Thunberg... Flower posters Agapanthus Allium Amaranthus Amaryllis Anemones Angelica Anthemis Anthuriums Asters Auricula Primula Azaleas Babiana Baby Tears Baby`s Breath Beard-Tongue Bee Balm Begonia Bird of... POSTER HOME FLOWER POSTERS Agapanthus Allium Aloe Vera Amaranthus Amaryllis Anemone Aster Auricula Primula Azalea Baby's Breath Bamboo Begonia Bird of Paradise Bleeding Hearts Bluebell Bougainvillea... coolmisthumidifier.mickhumidifiers.com /babysbreath   (848 words)

BONAP Distribution Data: US distribution of genus Amaranthus   (Site not responding. Last check: 2007-08-09) BONAP Distribution Data: US distribution of genus Amaranthus Also available: list of items mapped, checklist entries Click on a colored region below to get a listing of items in that area. csdl.tamu.edu /FLORA/cgi/b98_map?genus=Amaranthus&species=thunbergii   (31 words)

Try your search on: Qwika (all wikis)

About us   |   Why use us?   |   Reviews   |   Press   |   Contact us   Copyright © 2005-2007 www.factbites.com Usage implies agreement with terms.