Factbites
 Where results make sense
About us   |   Why use us?   |   Reviews   |   PR   |   Contact us  

Topic: Bathyteuthis


Related Topics

In the News (Sun 5 Jul 09)

  
  Bathyteuthis
The Bathyteuthis species occupy the lower mesopelagic to bathypelagic depth zones, and they are scattered throughout the world’s oceans.
Bathyteuthis was erected as a new genus by Hoyle (1885a) for a new species of deep sea squid (B.
Hoyle (1885b) immediately recognized that Benthoteuthis was a synonym of Bathyteuthis (which had publication priority by 2 months), and he mentioned in 1886 the possibility that the two species might be conspecific.
tolweb.org /tree?group=Bathyteuthidae   (1037 words)

  
 Bathyteuthoida
Buccal connectives attach to the ventral borders of Arms IV in the Chtenopterygidae and to the dorsal borders in the Bathyteuthididae.
The two genera that represent these families (Bathyteuthis, Cthenopteryx) were, at one time, placed within the same family (e.g., Naef, 1921) because they share a number of similar features.
They especially show strong similarities in the structure of the tentacular clubs, the sucker arrangement on the arms and the morphology of their gladii.
tolweb.org /tree/tree?group=Bathyteuthoida   (491 words)

  
 CEPHALOPODA - Online Information article about CEPHALOPODA
Cheiroteuthis has been taken at 2600 fms., Calliteuthis at 2200, Histiopsis at nearly 2000.
Bathyteuthis, placed in the same family as Ommatostrephes, has been taken at 1700 fms.
The Cranchiidae are remarkable for their small See also:
encyclopedia.jrank.org /CAU_CHA/CEPHALOPODA.html   (615 words)

  
 sp=bathyteuthis   (Site not responding. Last check: 2007-10-21)
AF000030 Bathyteuthis abyssicola cytochrome c oxidase subunit I (COI) gene, mitochondrial gene encoding mitochondrial protein, partial cds.
AY557483 Bathyteuthis abyssicola 18S ribosomal RNA gene, complete sequence.
AY557568 Bathyteuthis abyssicola 28S ribosomal RNA gene, partial sequence.
pbil.univ-lyon1.fr /cgi-bin/acnuc-search-sp?query=BATHYTEUTHIS&db=GenBank   (61 words)

  
 Bathyteuthis berryi
The holotype is housed at the Santa Barbara Museum of Natural History, California.
Several specimens of Bathyteuthis were discovered during a study of the deep pelagic cephalopods off the coast of Southern California (see Young, 1972).
They were determined to be a new species based especially on the extremely large number of suckers on arms I-III and the proportionally longer, attenuate arms (Roper, 1968).
tolweb.org /tree?group=Bathyteuthis_berryi   (465 words)

  
 CEPHALOPODA - LoveToKnow Article on CEPHALOPODA
Shell internal and chitinous, ending aborally in a little narrow cone; tentacular arms short and thick; suckers with denticulate rings.
Clenopteryx, fins pectinate, as long as the body; Bathyteuthis, fins terminal, rudimentary; tentacular arms, filiform; abyssal.
Rhynchoteuthss,tentacular arms united to form a beak-shaped appendage.
www.1911encyclopedia.org /C/CE/CEPHALOPODA.htm   (16353 words)

  
 GenBank: AF000030   (Site not responding. Last check: 2007-10-21)
LOCUS AF000030 657 bp DNA linear INV 17-MAR-1999 DEFINITION Bathyteuthis abyssicola cytochrome c oxidase subunit I (COI) gene, mitochondrial gene encoding mitochondrial protein, partial cds.
SOURCE mitochondrion Bathyteuthis abyssicola ORGANISM Bathyteuthis abyssicola Eukaryota; Metazoa; Mollusca; Cephalopoda; Coleoidea; Neocoleoidea; Decapodiformes; Bathyteuthidae; Bathyteuthis.
REFERENCE 1 (bases 1 to 657) AUTHORS Carlini,D.B. and Graves,J.E. TITLE Phylogenetic analysis of cytochrome c oxidase I sequences to determine higher-level relationships within the coleoid cephalopods JOURNAL Bull.
pbil.univ-lyon1.fr /cgi-bin/acnuc-search-id?query=AF000030&db=GenBank&ident=SCRATCH   (119 words)

  
 OUTPUT from blastn for SK3-0018   (Site not responding. Last check: 2007-10-21)
80 4e-13 gbAF234925.1AF234925 Bathyteuthis abyssicola clone 1 acti...
Sbjct: 664 tgacaggatgcagaaagaaatcacatctcttgctcccagcaccatgaagatcaagatcat 723 Query: 73 cgcccctccagagacgtaaatactccgatctggatcggaggctccatgcctggcttctct 132
>gbAF234925.1AF234925 Bathyteuthis abyssicola clone 1 actin gene, partial cds Length = 784 Score = 79.8 bits (40), Expect = 4e-13 Identities = 103/120 (85%), Gaps = 3/120 (2%) Strand = Plus / Plus Query: 13 tgacaggatgcagaaggaaattacctttctggctccctctaccatgaagatcaagatcat 72
cbr-rbc.nrc-cnrc.gc.ca /reith/salmon/kidney/SK3-0018.html   (3267 words)

Try your search on: Qwika (all wikis)

Factbites
  About us   |   Why use us?   |   Reviews   |   Press   |   Contact us  
Copyright © 2005-2007 www.factbites.com Usage implies agreement with terms.