
	Where results make sense

Topic: EcoRI

Related Topics

Restriction enzyme

Sticky end

	EcoRI - Wikipedia, the free encyclopedia
		In molecular biology, EcoRI (pronounced "Eco R One") is a commonly used restriction enzyme.
		The nucleic acid sequence where the enzyme cuts is GAATTC, which is a palindrome as the complementary sequence is CTTAAG. EcoRI, which is isolated from certain strains of E.
		EcoRI is prone to exhibit star activity if an excess of salts are present during the digestion.
	en.wikipedia.org /wiki/EcoR1 (121 words)

	Restriction Enzyme Action of EcoRI (Site not responding. Last check: 2007-10-12)
		Restriction enzymes, also called restriction nucleases (EcoRI in this example), surrounds the DNA molecule at the point it seeks(sequence GAATTC).
		It cuts one strand of the DNA double helix at one point and the second strand at a different, complementary point (between the G and the A base).
		EcoRI, one of many restriction enzymes, is obtained from the bacteria Escherichia coli.
	www.accessexcellence.org /AB/GG/restriction.html (84 words)

	Differences between EcoRI Nonspecific and "Star" Sequence Complexes Revealed by Osmotic Stress -- Sidorova and Rau 87 ...
		EcoRI (1.5 nM) was incubated for different times with a mixture of specific sequence DNA fragment (3 nM) and the TAATTC sequence oligonucleotide.
		EcoRI (1.5 nM) was incubated with specific sequence DNA fragment (3 nM) and varying concentrations of noncognate oligonucleotides in 75 mM NaCl, 20 mM imidazole (pH 7.0), 3.6 Osm betaine, and at 20°C. The gel mobility shift assay was used to monitor specific complex formation.
		Dissociation of EcoRI from the noncognate oligonucleotides is monitored by the increase in protein binding to the specific 360-bp DNA fragment with the incubation time.
	www.biophysj.org /cgi/content/full/87/4/2564 (7257 words)

	Effect of Tetrahydropyrimidine Derivatives on Protein-Nucleic Acids Interaction. TYPE II RESTRICTION ENDONUCLEASES AS A ... (Site not responding. Last check: 2007-10-12)
		Effect of THPs and Osmolytes on DNA Cleavage by EcoRI Endonuclease-- We have studied the effect of THP(A), THP(B), proline, and betaine on plasmid DNA cleavage by EcoRI endonuclease.
		Cleavage of pBR322 DNA by EcoRI endonuclease in the presence of THP(A).
		The inhibition of EcoRI endonuclease reaction by THP(A) was not compensated by increased concentration of MgCl
	intl.jbc.org /cgi/content/full/274/11/6920 (5775 words)

	[No title] (Site not responding. Last check: 2007-10-12)
		Charon 33 EcoRI FT -> Charon 34 [EcoRI-...-HindIII-BamHI-EcoRI] FT 1.
		pLS302 EcoRI FT linker 29bp tatcaagttcctgagttcgattcgtccac FT BamHI-NdeI, sacB gene FT \ pUC8 241..-..478 FT -> I 6300bp FT 1.
		I EcoRI 6300bp, 5' to sacB gene FT 2.
	www.infobiogen.fr /db/vector/VECTOR/incomplete.dat (7566 words)

	Recruitment of Single-Stranded Recombinant Adeno-Associated Virus Vector Genomes and Intermolecular Recombination Are ... (Site not responding. Last check: 2007-10-12)
		EcoRI in the presence of a 1:1 mixture of linearized pAAV.
		EcoRI vectors (sample 1), and a 1:1 mixture of two liver DNAs from mouse 1 (group 4) and mouse 10 (group 7), which were injected with only one vector (sample 2), were digested with a combination of BamHI and EcoRI and amplified by PCR with primer set EF1
		EcoRI (mice 11 and 12), or a combination of both (mice 6, 7, and 8), was infused through the tail vein as described in Materials and Methods, and liver samples were analyzed at 6 weeks postinjection in the same manner as that for the experiment shown in Fig.
	jvi.asm.org /cgi/content/full/74/20/9451 (8264 words)

	Methods
		The individual EcoRI DNA fragments from the cosmids are being further subcloned into a plasmid vector, resulting in a plasmid library consisting of clones each carrying one individual EcoRI DNA fragment.
		The plasmid clones containing the individual EcoRI fragments which were used for sequencing were purified by Qiagen column chromatography according to the protocol provided by the manufacturer (Qiagen).
		The plasmid carrying an EcoRI fragment from this cosmid received a "p" as prefix and the letter and number applied to the cosmid and additionally the size of the EcoRI fragment in kbp e.g.: pD2/4.8.
	www.zmbh.uni-heidelberg.de /M_pneumoniae/genome/Methods.html (1235 words)

	Cloning and Physical Mapping of the EcoRI Fragments of the Giant Linear Plasmid SCP1 -- Redenbach et al. 180 (10): 2796 ... (Site not responding. Last check: 2007-10-12)
		The SCP1 DNA was digested with EcoRI, separated by conventional agarose gel electrophoresis, and probed with the 13.0-kb right-end fragment of cosmid 53.
		The EcoRI digests of cosmids 53 and 31 were used as references.
		EcoRI fragment, the 3.8-kb SpeI-EcoRV fragment, the 7.6-kb XbaI-EcoRV
	jb.asm.org /cgi/content/full/180/10/2796 (2687 words)

	Transcription-coupled repair in RNA polymerase I-transcribed genes of yeast -- Conconi et al. 99 (2): 649 -- ... (Site not responding. Last check: 2007-10-12)
		After EcoRI digestion, DNA was separated on 1% native agarose gels, blotted, and hybridized with labeled rDNA probe.
		As controls, genomic DNA was isolated from uncrosslinked cells and digested with either EcoRI (lanes 1 and 14) or HindIII (lanes 3 and 12).
		The presence of active and inactive rDNA chromatin was monitored by digesting nuclei with EcoRI or HindIII before psoralen crosslinking and by redigesting the isolated DNA with EcoRI and HindIII, respectively (lanes 2 and 13, and lanes 4 and 11).
	www.pnas.org /cgi/content/full/99/2/649 (4482 words)

	Restriction Endonucleases (Site not responding. Last check: 2007-10-12)
		Different enzymes cleave at different positions within the recognition sequence, and may generate blunt fragments, or fragments with 5' or 3' overhanging ends.
		EcoRI isolated from Escherichia coli was the first restriction endonuclease to be described and the first whose structure was determined.
		The structure of EcoRV bound to a substrate oligonucleotide shows a remarkable degree of distortion in the DNA, which is substantially bent towards the enzyme at the minor groove.
	www.biochem.ucl.ac.uk /bsm/xtal/teach/rest/endo.html (431 words)

	Solving Problems (Site not responding. Last check: 2007-10-12)
		EcoRI: Digestion of this region of DNA should produce 5 fragments in addition to the thousands of others produced from the rest of the genome.
		EcoRI: The 1.5kbp band (e4) has disappeared and a 1.25kbp band has appeared.
		The simplest explanation for this is that 0.25kbp has been deleted from this region in the R allele to produce the r allele.
	web.mit.edu /esgbio/www/rdna/solvingblots.html (1927 words)

	The Kinetic Mechanism of EcoRI Endonuclease -- Wright et al. 274 (45): 31896 -- Journal of Biological Chemistry
		EcoRI endonuclease is among the simplest of the site-specific DNA enzymes and has proven useful for study of the mechanisms
		Enzymes and DNA-- Homogeneous EcoRI endonuclease was prepared as described previously (23).
		EcoRI endonuclease cleavage of linear pBR322 was performed at 37 °C in 0.02
	www.jbc.org /cgi/content/full/274/45/31896 (5599 words)

	An Epstein-Barr Virus Isolated from a Lymphoblastoid Cell Line Has a 16-Kilobase-Pair Deletion Which Includes gp350 and ...
		Southern blotting analysis of the SNU-265 genome using the HindIII E or EcoRI G2+F fragments as probes to determine the position of the SNU-265 deletion.
		Analysis using the Hind E probe also shows the fusion fragments on EcoRI and BamHI digestion, suggesting fusion of the EcoRI B fragment and the BamHI E fragment, respectively, with the left end in the BamHI a region (53).
		However, the EcoRI G2 and BamHI M fragments are clearly seen in the B95-8 and SNU-1103 control lanes.
	jvi.asm.org /cgi/content/full/75/18/8556 (7879 words)

	Automated Ribotyping of Vancomycin-Resistant Enterococcus faecium Isolates -- Brisse et al. 40 (6): 1977 -- Journal of ...
		EcoRI and the Statens Serum Institute (SSI) RiboPrinter.
		The arrow indicates the pattern into which a molecular size marker band of 1 kb was incorporated by the automated analysis of the RiboPrinter due to suboptimal electrophoretic migration.
		Strain names, EcoRI and BamHI ribogroups, sources, AFLP types, AFLP genogroups, MLST types, and presence or absence of the esp gene are indicated in the respective columns.
	jcm.asm.org /cgi/content/full/40/6/1977 (4668 words)

	Characterization of an unusual tRNA-like sequence found inserted in a Neurospora retroplasmid -- Mohr et al. 28 (13): 0 ...
		EcoRI digests of mtDNAs from wild-type 74A, Mauriceville (M), the growth impaired mutant V1-2 and Varkud (V) were run in a 0.6% agarose gel, blotted to Hybond-N and hybridized with a
		The probe hybridized to the 2.8-kb EcoRI fragment of pV1-2 in the V1-2 strain and to the 9.2-kb mtDNA EcoRI-3 (E-3) fragment in both Varkud and V1-2.
		EcoRI fragments of wild-type 74A mtDNA are numbered to the left of the gel.
	nar.oxfordjournals.org /cgi/content/full/28/13/0 (6901 words)

	Repair of Endonuclease-Induced Double-Strand Breaks in Saccharomyces cerevisiae: Essential Role for Genes Associated ... (Site not responding. Last check: 2007-10-12)
		Analysis of cell-cycle progression after induction of EcoRI expression in wild-type cells and in mutants deficient in recombination and/or NHEJ.
		EcoRI cleavage of chromosomal DNA are similar to those of rad52
		Expression of EcoRI in rad1 and rad1 rad52 strains caused an
	www.genetics.org /cgi/content/full/152/4/1513 (6160 words)

	Eco RI Endonuclease (Site not responding. Last check: 2007-10-12)
		Overall Architecture of the EcoRI dimer complex with DNA.
		The subunits of the EcoRI homodimer are labeled at their C-termini.
		Note the kink in the DNA at the center of the structure.
	www.bio.cmu.edu /Courses/03740/PS5/EcoRI.htm (447 words)

	Novel Polymorphism in the FMR1 Gene Resulting in a "Pseudodeletion" of FMR1 in a Commonly Used Fragile X Assay -- Daly ... (Site not responding. Last check: 2007-10-12)
		A: Patient DNA is digested with EcoRI (R) and SacII (S), then probed with the cloned fragment StB12.3.
		In contrast, digestion with EcoRI alone demonstrates the presence of a new EcoRI site in both the index patient and his mother, when compared to the normal male control.
		Genomic DNA was amplified using primers FMR1 and FMR7 to produce a 867-bp fragment spanning bases 14373 to 15240 in the FMR1 gene.
	jmd.amjpathol.org /cgi/content/full/2/3/128 (1970 words)

	Xenopus cDNA Library Information (Site not responding. Last check: 2007-10-12)
		After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107.
		After addition of EcoRI linkers and EcoRI-XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-4B columns and fractions containing cDNAs larger than 500 bp were ligated into EcoRI-XhoI-digested lambda ZAPII (UniZAP-XR) and packaged in vitro.
		After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and XhoI digestion, the cDNA was size-selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1 kb were ligated into EcoRI/XhoI digested pCS107 vector.
	image.llnl.gov /image/html/xenopuslib_info.shtml (4479 words)

	[No title]
		In order to give a brief summary of the working theory behind AFLP we will describe the technique as we use it to generate AFLPs between two Arabidopsis ecotypes, Columbia and Landsberg erecta.
		EcoRI cuts ~ every 2-2.5 Kb in Arabidopsis, while MseI cuts ~ every 300-400 bp.
		Adjust the volume of PCR cocktail such that the total rxn (cocktail + template) is 20 µL. Also amplify both WT1 and WT2 parents and any recombinants that have the WT2-specific band.
	www-ciwdpb.stanford.edu /publications/methods/aflp.html (3580 words)

	Simultaneous DNA Binding, Bending, and Base Flipping: EVIDENCE FOR A NOVEL M.EcoRI METHYLTRANSFERASE-DNA COMPLEX -- ...
		EcoRI endonuclease, and the final donor emission was used to
		Inset, no FRET effect is seen with a non-bending enzyme that binds the substrate DNA as determined by x-ray crystallographic studies (70).
		FRET with the EcoRV endonuclease, EcoRI endonuclease, and M.EcoRI,
	www.jbc.org /cgi/content/full/279/35/37049 (7322 words)

	Meta-Analysis Suggests Association of L-myc EcoRI Polymorphism with Cancer Prognosis -- Spinola et al. 10 (14): 4769 -- ...
		Meta-analysis of effects of L-myc EcoRI polymorphism on lymph node status of lung cancer patients.
		Meta-analysis of effects of L-myc EcoRI polymorphism on distant metastasis status of lung cancer patients.
		Meta-analysis of effects of L-myc EcoRI polymorphism on tumor progression parameters and cancer risk in all types of cancers, in patients with S/S L-myc genotype minus those in patients with L/L L-myc genotype.
	clincancerres.aacrjournals.org /cgi/content/full/10/14/4769 (3539 words)

	Very low penetrance in 85 Japanese families with facioscapulohumeral muscular dystrophy 1A -- Goto et al. 41 (1): 12 -- ...
		Figure 2 EcoRI fragment size of parents with a deleted allele.
		The mother in F143 (arrowhead) had four BlnI resistant EcoRI fragments (fl arrows) that included a faint 17 kb fragment and one BlnI sensitive EcoRI fragment (white arrow).
		EcoRI fragment were variable and did not correlate with the
	jmg.bmjjournals.com /cgi/content/full/41/1/e12 (2985 words)

	Restriction.html (Site not responding. Last check: 2007-10-12)
		ecori or EcoR1 are not enzymes, EcoRI and KpnI are.
		This site does not exist in a linear sequence as the EcoRI site is split into two halves at the start and the end of the sequence.
		EcoRI finds a site at position 2 even if it is highly unlikely that EcoRI accepts to cut this site in a tube.
	www.biopython.org /docs/cookbook/Restriction.html (6223 words)

	Palindromati. Fernando Castro-Chavez. 2005. ISCID, IS for Complexity, Information and Design.
		EcoRI palindromic linker to produce artificial heterotranscripts such as the ones reported here and present in the
		In that sequence, it is indicated the use of the vector
		EcoRI enzymatic digestion may be explained by a phenomenon of self-hybridization performed by the linker (Figure 3), which could make it to appear as an appendage impossible to be grasped by the digestive enzyme.
	www.geocities.com /plin9k (3244 words)

	Requirement for End-Joining and Checkpoint Functions, but Not RAD52-Mediated Recombination, after EcoRI Endonuclease ...
		Expression of EcoRI and HO from centromeric plasmids inhibits the growth of rad52 and rad9 strains.
		Expression of EcoRI causes growth inhibition and cell killing in hdf1 mutants.
		We have shown that EcoRI endonuclease expression is lethal in Ku-deficient end-joining mutants and checkpoint-defective rad9
	mcb.asm.org /cgi/content/full/18/4/1891 (6636 words)

	Human cDNA Library Information (Site not responding. Last check: 2007-10-12)
		Library is normalized; constructed in the laboratory of M. Bento Soares (University of Iowa).
		Library is normalized (non-normalized version of the library is NCI_CGAP_DF0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa).
		Library is normalized (non-normalized version of the library is NCI_CGAP_ED0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa).
	image.llnl.gov /image/html/humlib_info.shtml (4795 words)

	Retrotransposable Elements R1 and R2 in the rDNA Units of Drosophila mercatorum: abnormal abdomen Revisited -- Malik ...
		The 5' untranslated region of each class is indicated with hatched boxes, while the regions that encode the beginning of the first ORF are indicated by the shaded boxes.
		The PCR primers used in the amplification were located within the 28S gene, 90 bp upstream of the insertion site and ~120 bp from the 5' end of the R1 elements.
		Genomic DNA from each strain was digested with EcoRI and probed with a 530-bp fragment of the 28S gene upstream of the R1 and R2 insertion sites (see Figure 4A).
	www.genetics.org /cgi/content/full/151/2/653 (7477 words)

	Focus-formation of replication protein A, activation of checkpoint system and DNA repair synthesis induced by DNA ...
		A in the presence of EcoRI was not influenced by caffeine treatment.
		The nuclear fraction was subjected to SDS-polyacrylamide gel electrophoresis directly (lanes 1,2), or after incubation with (lanes 3,4) or without (lanes 5,6) MNase followed by centrifugal separation of supernatant (lanes 3,5) and precipitated (lanes 4,6) fractions.
		The extent of DNA synthesis is represented as a percentage of accumulative DNA synthesis after a 90 minute incubation in the absence of DNA damaging agents.
	jcs.biologists.org /cgi/content/full/115/15/3159 (7224 words)

	Molecular characterization of a deletion/duplication rearrangement in tfd genes from Ralstonia eutropha JMP134(pJP4) ...
		EcoRI fragments C, E, F, H and I, as well as the HindIII-B, -D, -E and -H and BamHI-B
		The approximate positions of the tfd and mer genes and the ISJP4, IR-R-ISJP4, IS1071 and IS1071-like elements are shown.
		The EcoRI-A, -F, -H and -I fragments from wild-type pJP4, and the EcoRI-A' and -E' fragments from pJP4-F3 hybridized with the IS1071 probe.
	mic.sgmjournals.org /cgi/content/full/147/8/2141 (4017 words)

Try your search on: Qwika (all wikis)