
	Where results make sense

Topic: Emeus

In the News (Tue 14 Feb 12)

EXECUTIVE POWER

Iran

ANALYSIS

Pakistan

Family compact

	Eastern moa - Wikipedia, the free encyclopedia
		The Eastern Moa, Emeus crassus, is an extinct species of ratite bird belonging to the moa family.
		Emeus was of average size, standing 150 cm (5 ft) tall.
		Because of this, human colonists hunted Emeus into extinction with relative ease.
	en.wikipedia.org /wiki/Emeus (243 words)

	Émeu Ville - Information (emu)
		The emeu is native to Australia and sits on the right hand side of the Australian Coat of Arms, with the kangaroo on the left.
		From 1930 to 1950, the emeu, of the same family as the ostrich, was a major attraction in zoos due to its unique appearance.
		The emeu stands at a height of 1.5 to 1.8 meters (5 to 6 feet) and weighs 50 to 63.6 kg (110 to 140 lbs).
	www.directnetdesign.com /users/emeu/en/inform.asp (542 words)

	[No title]
		The emeus have no helmet, their head is feathered, their neck has no caruncles, and their inner toes bear a claw of no singular character.
		Of the emeus (as the word is now restricted) the best known is the Casuarius novae-hollandiae of John Latham, made by Vieillot the type of his genus Dromaeus,2 whence the name of the family (Dromaeidae) is taken.
		The nest is a shallow pit scraped in the ground, and from nine to thirteen eggs, in colour varying from a bluish-green to a dark bottle-green, are laid therein.
	encyclopedia.jrank.org /correction/edit?locale=en&content_id=22896 (1090 words)

	Moa - LoveToKnow 1911
		The feathers have a large after-shaft which is of the size of the other half, likewise in agreement with the Australian Ratitae, while in the others, including the kiwis, the after-shaft is absent.
		In this respect cassowaries and emeus hold an intermediate position, their occasional zoophagous (especially piscivorous) inclination being well known.
		Unmolested by enemies (Harpagornis, a tremendous bird of prey, died out with the Pleistocene), living in an equable insular climate, with abundant vegetation, the moas flourished and seem to have reached their greatest development in specialization, numbers, and a bewildering variety of large and small kinds, within quite recent times.
	www.1911encyclopedia.org /Moa (677 words)

	Incubation of Birds' Eggs
		In the phalaropes -- a group similar to the sandpipers -- the female is more brightly colored than the male and he not only incubates the eggs but also takes care of the young.
		Among such big flightless birds as the ostriches, cassowaries and emeus, it is said that the male tends to all or most of the domestic chores.
		Sparrows require from 11 to 13 days; thrushes, including the robin, 13 or 14; domestic chickens 21; ducks, depending on the size, from 21 to 30; geese, from 30 to 35; and 50 to 60 days for ostriches.
	www.newton.dep.anl.gov /natbltn/400-499/nb456.htm (659 words)

	[No title] (Site not responding. Last check: 2007-10-25)
		e-ma-the'-is (Amathias; Emeus; Codex Vaticanus, Emaththis; Codex Alexandrinus, Ematheis; the King James Version, Amatheis): One of the sons of Bebai (1 Esdras 9:29), called "Athlai" in Ezra 10:28.
		DISCLAIMER: Church of the Great God (CGG) provides these resources to aid the individual in studying the Bible.
		The content of these resources does not necessarily reflect the views of CGG.
	bibletools.org /index.cfm/fuseaction/Def.show/RTD/isbe/ID/3046/printer/friendly (81 words)

	untitled
		; 5 letters : "delta" "egale" "emeus" "etire" "gener" "gnous" "maree" ;"ornas" "relue" "satin" "verre"
		(var (name h8) (possible-values (create$ "delta" "egale" "emeus" "etire" "gener" "gnous" "maree" "ornas" "relue" "satin" "verre")))
		(var (name h18) (possible-values (create$ "delta" "egale" "emeus" "etire" "gener" "gnous" "maree" "ornas" "relue" "satin" "verre" "tente")))
	www.droit.univ-paris5.fr /HTMLpages/enseignants/staff/futtersack/english/research/CCP/crosswd.html (3423 words)

	Cullman.Com News - Obituaries (Site not responding. Last check: 2007-10-25)
		Kilpatrick is survived by his wife, Birdie M. Kilpatrick; one son, Todd Kilpatrick of Cullman; three daughters and son-in-laws, Decca and Joe Rusk, Rita and Gene Rusk, and Cindy and James Butler, all of Cullman; one sister, Mildred Peinhardt of Cullman; eight grandchildren and four great-grandchildren.
		Kilpatrick will be held at Emeus Baptist Church on July 26, 1999, at 2:00 p.m., Rev. Greg Aldridge and Rev. James Blackwood officiating.
		Kilpatrick will be buried at Emeus Baptist Church Cemetery.
	www.cullman.com /news/obituaries/1999/killpatrick-072699.html (134 words)

	RID=1034793571-026510-4206,
		Emeus crassus mitochondrion, partial genome Length = 16662 Score = 525 bits (265), Expect = e-146 Identities = 628/747 (84%), Gaps = 3/747 (0%) Strand = Plus / Plus Query: 7 ccaagcccatgaccaatcttcggcgcagccgcagcactactaaccacctctggcctaatc 66
		Sbjct: 10878 tttggcttcgaagcagcagcctgatattgacacttcgtagacgtcatctgattattcctc 10937 Query: 726 tacatatccatatactgatgaggatc 751
		Emeus crassus mitochondrion, complete genome Length = 17061 Score = 517 bits (261), Expect = e-144 Identities = 627/747 (83%), Gaps = 3/747 (0%) Strand = Plus / Plus Query: 7 ccaagcccatgaccaatcttcggcgcagccgcagcactactaaccacctctggcctaatc 66
	www.mit.edu /people/jocelyns/classes/hst730/blast7a.html (3569 words)

	THE ROOM WITH THE MOA THAT WE’RE NOT SUPPOSED TO WRITE ABOUT
		In the North Island the moas seem to have died out about 500–700 years ago, probably before the arrival of the Maoris.
		In the South Island moas of the genus Emeus lingered much longer, possibly in the unexplored interior even down to the time when Capt. James Cook visited New Zealand (1769).” (Encyclopedia Britannica)
		One Tuesday in October, Miss Gold’s 4th grade class went on a field trip to the Natural History Museum, a cavernous old building with stone floors and worn marble staircases that echoed.
	ourworld.compuserve.com /homepages/karlahuebner/moa.htm (686 words)

	Stories - 1st Alabama Cavalry, USV (Site not responding. Last check: 2007-10-25)
		Emily moved from Lawrence County, Tennessee back to Cullman County, Alabama in late 1894 or early 1895 and lived near her two sons and invalid daughter until her death 11 February 1909.
		Emily Alvis is buried near her children in the Emeus Cemetery near Logan in Cullman County.
		Henry S. Alvis' son David H. Alvis also served in the 1st Alabama Cavalry.
	www.1stalabamacavalryusv.com /roster/stories.asp?trooperid=30 (1145 words)

	EMEU VILLE (Site not responding. Last check: 2007-10-25)
		School Tours: Interactive, educational farm experience tailored to age group.
		Learn about emeus from hatching to full-grown birds as well as other members of the ratite family.
		You'll be amazed at the variety of unique products.
	www.countryvacations.mb.ca /emeuville (105 words)

	:: Professor Paul's Guide to Birds : Dinornithiformes ;Moas : Extinct birds,family Emeidae ;moas : Emeus (Site not responding. Last check: 2007-10-25)
		:: Professor Paul's Guide to Birds : Dinornithiformes ;Moas : Extinct birds,family Emeidae ;moas : Emeus
		The Eastern Moa lived in scrub and low forest in the eastern South Island and stood about 1.5 metres tall and weighed about 51–70 kilograms.
		Males may have had lek behavior or even been noctural.
	www.ppne.co.uk /index.php?m=show&id=196 (228 words)

	GEISHA BLASTN report for 16V_T7
		>gi14039567gbAF338712.1AF338712 Emeus crassus mitochondrion, partial genome Length = 16662 Score = 565 bits (285), Expect = e-158 Identities = 651/773 (84%) Strand = Plus / Plus Query: 1 tggcacaccaagcacactcctaccacatagttgacccaagcccatgaccaatcttcggcg 60
		Sbjct: 8677 tggcacaccaagcacactcctatcacatagtagatccaagcccatggcccatcttcggcg 8736 Query: 61 cagccgcagcactactaaccacctctggcctaatcataaggttccactacagctcgacca 120
		Emeus crassus mitochondrion, complete genome Length = 17061 Score = 557 bits (281), Expect = e-156 Identities = 650/773 (84%) Strand = Plus / Plus Query: 1 tggcacaccaagcacactcctaccacatagttgacccaagcccatgaccaatcttcggcg 60
	geisha2.biosci.arizona.edu /data/blastn/16V_T7.html (4830 words)

	GEISHA BLASTN report for 78H_T7
		>gi14039567gbAF338712.1AF338712 Emeus crassus mitochondrion, partial genome Length = 16662 Score = 240 bits (121), Expect = 1e-60 Identities = 309/369 (83%), Gaps = 2/369 (0%) Strand = Plus / Plus Query: 2 tggcacaccaagcacactcctaccacatagttgacccaagcccatgaccaatcttcggcg 61
		Sbjct: 8977 tcttccactcaagcctagcacccacccccgaactaggcggactatggcccc-caacagga 9035 Query: 361 gtcaaaccc 369
		Emeus crassus mitochondrion, complete genome Length = 17061 Score = 240 bits (121), Expect = 1e-60 Identities = 309/369 (83%), Gaps = 2/369 (0%) Strand = Plus / Plus Query: 2 tggcacaccaagcacactcctaccacatagttgacccaagcccatgaccaatcttcggcg 61
	geisha2.biosci.arizona.edu /data/blastn/78H_T7.html (4357 words)

Try your search on: Qwika (all wikis)