
	Where results make sense

Topic: Erythrovirus

Related Topics

Virus classification

Virology

Museum of Reconstruction

Law of total tricks

Jewish principles of faith

Sagittarius Dwarf Irregular Galaxy

Spaghetti House siege

Academy Award for Documentary Feature

Yorkshire three peaks

William of Orange

Amihai Mazar

Anton van Leeuwenhoek

In the News (Fri 25 Dec 09)

Northern Trust

Marvin Harrison

Peter Chernin

Gary Locke

Match Play

Penelope Cruz

Mickey Rourke

AR Rahman

Danny Boyle

Hugh Jackman

	Indian Journal of Medical Research: Erythrovirus B19 infection in humans
		Erythrovirus B19 (19) previously called parvovirus B19 is the only human pathogen in the family Parvoviridae.
		The erythrovirus B19 (B19) previously known as parvovirus 1319 is among the smallest of the animal DNA viruses.
		Cossart and colleagues' in 1975 discovered the human erythrovirus B19, the only member in the Parvoviridae family that is pathogenic to man, while screening healthy blood donors for hepatitis B. The virus was independently described also in France and Japan, where it was called Aurillac or Nakatani antigen respectively2.
	www.findarticles.com /p/articles/mi_qa3867/is_200011/ai_n8906323 (1388 words)

	Identification and Characterization of Persistent Human Erythrovirus Infection in Blood Donor Samples -- Candotti et ...
		(6, 7), and genotyped erythrovirus sequences from the GenBank
		The presence of antibodies to VP2 in erythrovirus DNA-positive
		Prevalence of human erythrovirus B19 DNA in healthy Belgian blood donors and correlation with specific antibodies against structural and non-structural viral proteins.
	jvi.asm.org /cgi/content/full/78/22/12169 (6579 words)

	Novel Human Erythrovirus Associated with Transient Aplastic Anemia -- Nguyen et al. 37 (8): 2483 -- Journal of Clinical ...
		Erythrovirus (formerly parvovirus) B19 causes a wide range of diseases in humans, including anemia due to aplastic crisis.
		Erythrovirus B19 sequences 1 (ebu38506) and 2 (ebu38507) were isolated from Chinese patients, and B19 sequence 24 (pvb19x556) came from a patient suffering from persistent B19 infection.
		Detection of an erythrovirus sequence distinct from B19 in a child with acute anemia.
	jcm.asm.org /cgi/content/full/37/8/2483 (3204 words)

	Genetic Diversity within Human Erythroviruses: Identification of Three Genotypes -- Servant et al. 76 (18): 9124 -- The ...
		Erythrovirus isolate D91.1 was detected in a panel D serum sample
		The erythrovirus strain D91.1 clusters with but is notably distant from V9.
		The human erythrovirus sequences are distributed into three distinct clusters corresponding to genotype 1 (prototype strain Pvbaua), genotype 2 (prototype strain Lali), and genotype 3 (prototype strain V9).
	jvi.asm.org /cgi/content/full/76/18/9124 (7226 words)

	DHEA, antibiotics, Weight Loss drugs, weight loss herbs, weight loss herbal formula, hair loss, hair growth, buy Rx ... (Site not responding. Last check: 2007-11-05)
		B19 virus is a human virus belonging to the genus Erythrovirus: The genetic diversity among B19 virus isolates has been reported to be very low, with less than 2% nucleotide divergence in the whole genome sequence.
		We have previously reported the isolation of a human erythrovirus isolate, termed V9, whose sequence was markedly distinct (>11% nucleotide divergence) from that of B19 virus.
		Additional phylogenetic analysis of partial sequences from the V9-related isolates combined with erythrovirus sequences available in GenBank indicates that the erythrovirus group is more diverse than thought previously and can be divided into three well-individualized genotypes, with B19 viruses corresponding to genotype 1 and V9-related viruses being distributed into genotypes 2 and 3.
	twinpharm.com /ref-genome-2/genome-2-research-abs4.825.html (1175 words)

	Virologisk forskning
		Based on ethical considerations alone, research into therapeutic cloning should be encouraged in order to develop therapeutic applications of stem cells.
		Diagnosis of erythrovirus B19 (B19) relies on serology and the detection of viral DNA.
		Recently, a distinct erythrovirus isolate termed V9, markedly different from erythrovirus B19 (> 11% nucleotide disparity), was isolated.
	www.virologi.dk /resultat02.htm (1560 words)

	Human Parvovirus B-19 (Site not responding. Last check: 2007-11-05)
		It's believed that this is caused by VP2, as this structural protein can induce the production of autoantibodies for keratin, collagen, and cardiolipin due to cross-reactivity.
		HPV B-19 virus infects and lyses erythroid progenitor cells in the bone-marrow (hence the name erythrovirus), which are the precursors for red-blood- cells (remember, parvovirus can only infect cells that are actively replicating, as the virus has no way of forcing the cell into mitosis).
		The virus uses the blood group cell receptor P antigen found on erythroblasts, megakaryoblasts, endothelial cells, and fetal myocardial cells.
	www.stanford.edu /group/virus/parvo/2004oleary/parvo.html (358 words)

	Documento sem título
		Erythrovirus B19 infection is usually benign but may have serious consequences in patients with hemolytic anemia (transient aplastic crisis), immunodeficiency (in whom persistent infection can lead to chronic bone marrow failure with anemia), or who are in the first or second trimester of gestation (spontaneous abortion, hydrops fetalis, and fetal death).
		Erythrovirus (formerly parvovirus) B19 and the novel Erythrovirus V9 are by now the only parvoviruses implied in human disease (Laub and Strengers 2002).
		Infection with Erythrovirus B19 (from now on referred as B19) causes erythema infectiosum (Anderson et al.
	memorias.ioc.fiocruz.br /991/4918.html (1311 words)

	UpToDate Epidemiology and laboratory diagnosis of parvovirus B19 infection
		The focus here will be limited to those viruses of the former subfamily that cause human illness: the Erythrovirus genera, which consists of B19, A6, K71 and V9 strains.
		These three newly described variants of B19 have overall nucleotide sequence variations of 11 to 12 percent compared to B19; the divergence at the amino acid level among strains is significantly less than that seen at the nucleotide level.
		Unless otherwise specified, human parvovirus B19 (B19) will be the strain referred to when describing the spectrum of disease manifestations, epidemiologic patterns and diagnostic testing related to Erythrovirus infections.
	patients.uptodate.com /topic.asp?file=viral_in/11250&title=Arthritis (498 words)

	Infections of the Fetus and Newborn Infant
		CMV, HSV, Erythrovirus (Parvovirus) B19, Enteroviruses, Hepatitis B virus, VZV, HIV, Rubella.
		CMV, HSV, Erythrovirus (Parvovirus) B19, Rubella, Hepatitis B virus, HIV, VZV, Treponema pallidum, Toxoplasma gondii.
		Pregnant women are exposed to the infections in the community and are also more likely to be exposed to infections associated with young children.
	www.kcom.edu /faculty/chamberlain/Website/lectures/lecture/congen.htm (3114 words)

	[No title]
		These specimens are stored for 1-2 years and can be used for pre-exposure screening.
		Infection in Pregnancy Infections which can cause problems for the foetus are varicella zoster virus, erythrovirus (parvovirus) B19, rubella, toxoplasma, measles, mumps, herpes simplex virus and cytomegalovirus.
		Contact in Pregnancy Varicella zoster virus, erythrovirus B19, rubella.
	www.clinical-virology.org /sops/OG_guide.doc (598 words)

	[No title]
		In non-specific illnesses such as malaise, tiredness, myalgia etc., unless there are localising symptoms / signs, it is not worth sending sera.
		Sera remain useful, especially for HIV, hepatitis viruses, erythrovirus B19, measles, rubella, EBV and Mycoplasma pneumoniae.
		We can test for immunity (from natural exposure) to - CMV, EBV, erythrovirus B19, HAV, HBV, VZV and T. gondii.
	www.clinical-virology.org /sops/GP_guide.doc (626 words)

	Genetic Diversity within Human Erythroviruses: Identification of Three Genotypes -- Servant et al. 76 (18): 9124 -- The ...
		B19 virus is a human virus belonging to the genus Erythrovirus.
		of a human erythrovirus isolate, termed V9, whose sequence was
		Liu, Z., Qiu, J., Cheng, F., Chu, Y., Yoto, Y., O'Sullivan, M. G., Brown, K. E., Pintel, D. Comparison of the Transcription Profile of Simian Parvovirus with That of the Human Erythrovirus B19 Reveals a Number of Unique Features.
	jvi.asm.org /cgi/content/abstract/76/18/9124 (531 words)

	[No title]
		Parvoviridae: 20 nm in diamenter, naked icosahedral nucleocapsids, ssDNA (5kb), narrow host range, replicate in rapidly dividing cells, can establish latent infections with viral DNA integrated within the host genome.
		Examples: Erythrovirus (human parvovirus B19), erythemia infectiosum, hemolytic anemia.
		Papovaviridae: 55 nm in diameter, naked icosahedral nucleocapsid, circular ds DNA (5-8kb), replicates in the nucleus and may transform cells, persists as an episome.
	www.sciencedigest.org /TAXVIR.HTM (732 words)

	Advances in the biology, diagnosis and host-pathogen interactions of parvovirus B19 -- Corcoran and Doyle 53 (6): 459 ... (Site not responding. Last check: 2007-11-05)
		2 and erythrovirus V9 (Nguyen et al., 1998) as the prototype
		that this V9 isolate is an emerging virus and that this erythrovirus
		Heegaard, E. D., Panum Jensen, I. and Christensen, J. Novel PCR assay for differential detection and screening of erythrovirus B19 and erythrovirus V9.
	jmm.sgmjournals.org /cgi/content/full/53/6/459 (9478 words)

	Parvovirus Infections - Patient UK
		Unlike others it has no lipid coat and is thus very hardy (can survive at -80ºC almost indefinitely) and resistant to disinfection.
		Parvovirus B19 (PV-B19, sometimes called erythrovirus) is the only parvovirus known to be pathogenic to humans.
		Presentation It is normally spread by respiratory droplets and across the placenta or by
	www.patient.co.uk /showdoc/40024615 (1109 words)

	[No title] (Site not responding. Last check: 2007-11-05)
		Parvovirus B19 is an erythrovirus causing diverse clinical manifestations ranging from asymptomatic or mild, to more severe outcomes in, for example, immune-compromised patients.
		B19 is spread primarily via the respiratory route, but it can also be transmitted via blood and blood products.
		The assay is validated according to current guidelines (of the International Conference on Harmonization, Paul Ehrlich Institute, and the Council of Europe) and is optimized for high throughput screening.
	www.elsevier.com /cdweb/journals/01660934/articles/92/2/S016609340000292.abstract.en (219 words)

	RID=1066948713-3991-1047132.BLASTQ3, (Site not responding. Last check: 2007-11-05)
		>gi5639965gbAF161226.1AF161226 Erythrovirus B19 isolate Kati4 NS1 and VP1/2 genes, partial cds Length = 4279 Score = 42.1 bits (21), Expect = 3.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 46 cagtagcagtcatgcagaacc 66
		>gi5639962gbAF161225.1AF161225 Erythrovirus B19 isolate Kati3 NS1 and VP1/2 genes, partial cds Length = 4268 Score = 42.1 bits (21), Expect = 3.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 46 cagtagcagtcatgcagaacc 66
		>gi4092539gbAF113323.1AF113323 Erythrovirus B19 nonstructural protein NS1 (ns1), structural protein VP1 (vp1), and structural protein VP2 (vp2) genes, complete cds Length = 4538 Score = 42.1 bits (21), Expect = 3.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 46 cagtagcagtcatgcagaacc 66
	www.micro.utexas.edu /grad/timmer/BLASTs/Blast_files120303/Rice.171.html (4952 words)

	The structure of human parvovirus B19 -- Kaufmann et al. 101 (32): 11628 -- Proceedings of the National Academy of ...
		genus Erythrovirus, which is characterized by a high tropism
		(10) have also been proposed to be members of the Erythrovirus
		Little is known about the molecular basis of infection
	www.pnas.org /cgi/content/full/101/32/11628 (3727 words)

	Human Parvovirus B19 -- Heegaard and Brown 15 (3): 485 -- Clinical Microbiology Reviews
		Dependovirus), or preferentially in erythroid cells (genus Erythrovirus)
		Excerpt of the current classification of the subfamily Parvovirinae, including proposed members of the genus Erythrovirus placed tentatively (147)
		Although currently B19 is the only member of the Erythrovirus
	cmr.asm.org /cgi/content/full/15/3/485 (7847 words)

	[No title]
		Previously obtained sera showed her to have been negative for this virus and her donor to have been positive.
		Although anemia is seen in about 40% of recipients of renal transplants, reports of erythrovirus induced red cell aplasia or hemophagocytosis are rare.
		Could this condition be more common than we think?
	www.blackwellpublishing.com /isth2003/abstract.asp?id=18357 (216 words)

	Tramadol, buy tramadol, antibiotics, Weight Loss drugs, weight loss herbs, weight loss herbal formula, hair loss, hair ...
		Nguyen QT, Wong S, Heegaard ED, Brown KE.
		Parvovirus B19 (B19), currently the only accepted member of the Erythrovirus genus, is the only parvovirus known to be pathogenic in humans.
		Recently a viral sequence, tentatively termed V9 which showed 11% variability from the published B19 sequences, was described from a patient with aplastic crisis.
	hair-loss-stop.com /ref-pathogen-1/pathogen-research-abs5.1196.html (1559 words)

	DanforthCenter.org
		• Human parvovirus B19 - A6, (B19V-A6), Human parvovirus B19, Erythrovirus, Parvovirinae, Parvoviridae
		• Human parvovirus B19 - Au, (B19V-Au), Human parvovirus B19, Erythrovirus, Parvovirinae, Parvoviridae
		• Human parvovirus B19 -LaLi, (B19V-LaLi), Human parvovirus B19, Erythrovirus, Parvovirinae, Parvoviridae
	www.danforthcenter.org /iltab/ICTVnet/asp/iVirusIndexResults.asp?Ltr=H&Mode=Alpha (6004 words)

Try your search on: Qwika (all wikis)