
	Where results make sense

Topic: Ficedula

In the News (Tue 22 Dec 09)

Northern Trust

Marvin Harrison

Peter Chernin

Gary Locke

Match Play

Penelope Cruz

Mickey Rourke

AR Rahman

Danny Boyle

Hugh Jackman

	Ficedula Attività (Site not responding. Last check: 2007-11-02)
		FICEDULA was founded in 1981 after the Society for the Study and Protection of Birds of Lugano was dissolved (1931-1979).
		The Collared Flycatcher (Ficedula albicollis) bread in Switzerland only in the regions where Italian is spoken.
		Various books of FICEDULA are deposited with many journals and magazines received in exchange at the Biblioteca Cantonale in Mendrisio (naturalistic section) [via Agostino Maspoli, CH-6850 Mendrisio].
	www.ficedula.ch /english.html (182 words)

	The Final Fantasy VII Citadel: Game Information
		Ficedula: Not much—I never really had the patience to decode the file formats, anyway; my programs just ended up getting used because I was usually the first person to kick out a visual app for viewing or hacking the files, usually after somebody else did the preliminary work of working out the file formats.
		Ficedula: I'm certainly interested in Advent Children; everybody seems to be worried AC is going to suck and ruin the whole FF7 storyline, but I think it's well worth waiting to see what it's like.
		Ficedula: Japanese media has never seemed to consider storylines as sacrosanct—look at the number of anime that release a new series which is a completely different take on the original.
	www.ff7citadel.com /gameinfo/feat_hacking.shtml (3172 words)

	Unknown Ficedula in Namibia
		The white in the wings closely matched the illustrations of shown for these Ficedula flycatchers, but the white at the base of the primaries was not as extensive as illustrated for Collared and Semi-collared and was more suggestive of Pied, again, this is judging solely from the illustrations I have at hand.
		Ficedula flycatcher (Pied, Collared, Semi-collared) in Windhoek, Namibia.
		Ficedula flycatchers and suspect your bird is pied flycatcher because:
	www.greglasley.net /ficedula.html (6635 words)

	Pied flycatcher - Ficedula hypoleuca: More Information - ARKive
		The birds can vary somewhat in their plumage depending on the local race of the species.
		There is a closely related bird found in central Europe, Asia Minor and North West Africa called the collared flycatcher (Ficedula albicollis).
		They are very similar in appearance to the pied flycatcher and, where the two species’ ranges overlap, hybrids have been known to occur.
	www.arkive.org /species/ARK/birds/Ficedula_hypoleuca/more_info.html (702 words)

	Nest-attenders in the Pied Flycatcher (Ficedula hypoleuca) during nestling rearing: A possible case of prospective ...
		Nest-attenders in the Pied Flycatcher (Ficedula hypoleuca) during nestling rearing: A possible case of prospective resource exploration
		The Pied Flycatcher (Ficedula hypoleuca) is a small, migratory, monogamous, or facultatively polygynous bird breeding in tree holes and nest boxes (Lundberg and Alatalo 1992).
		A female produces one clutch per season that she incubates alone, but parents divide nestling feeding approximately equally (Alatalo et al.
	findarticles.com /p/articles/mi_qa3793/is_200110/ai_n8954725 (925 words)

	Photo Gallery Macro Insects Bugs Flowers Landscape - Svartvit flugsnappare, Ficedula hypoleuca, Pied Flycatcher
		Photo Gallery Macro Insects Bugs Flowers Landscape - Svartvit flugsnappare, Ficedula hypoleuca, Pied Flycatcher
		Svartvit flugsnappare, Ficedula hypoleuca, Pied Flycatcher, Fåglar, Birds
		Rate this picture (currently 2.59 / 5 with 17 votes)
	www.screem.nu /pic_details.php?pid=114 (41 words)

	Internatura: Anuario Ornitologico de la Comunidad Valenciana: Indice
		Papamosca papirrojo ; Papamosques menut ; Ficedula parva
		Papamoscas collarino ; Papamosques de collar ; Ficedula albicollis
		Papamosca cerrojillo ; Papamosques blanquet ; Ficedula hypoleuca
	www.internatura.uji.es /anuario/indice.html (1701 words)

	GEISHA BLASTN report for V48_T3
		Ficedula semitorquata isolate hs1 aldolase B (AldoB) gene, intron 4 and partial cds Length = 234 Score = 75.8 bits (38), Expect = 6e-11 Identities = 44/46 (95%) Strand = Plus / Plus Query: 438 ctggctgagcgctgtgcccagtacaagaaagatggtgctgactttg 483
		Ficedula semitorquata isolate as1 aldolase B (AldoB) gene, intron 4 and partial cds Length = 234 Score = 75.8 bits (38), Expect = 6e-11 Identities = 44/46 (95%) Strand = Plus / Plus Query: 438 ctggctgagcgctgtgcccagtacaagaaagatggtgctgactttg 483
		Ficedula hypoleuca aldolase B (AldoB) gene, intron 4 and partial cds Length = 234 Score = 75.8 bits (38), Expect = 6e-11 Identities = 44/46 (95%) Strand = Plus / Plus Query: 438 ctggctgagcgctgtgcccagtacaagaaagatggtgctgactttg 483
	geisha.biosci.arizona.edu /data/blast/blastn/V48.html (0 words)

	untitled
		The authors subsequently identified it as a male Green-backed Flycatcher Ficedula elisae (formerly known as Chinese Narcissus Flycatcher), at which time they also realised the full significance of the record, ie.
		As a long-distance migrant to the south and breeding due north of Hong Kong occurring during the peak of spring Ficedula migration, this species was accepted by the Records Committee of the Hong Kong Bird Watching Society into Category A of the Hong Kong List.
		Whilst undoubtedly a candidate for the bird trade, its restricted distribution and rarity in the wild, in addition to the timing of occurrence, make this highly unlikely to be the provenance of the bird.
	www.birdinghawaii.co.uk /XGBFlycatcher2.htm (0 words)

	Singing is not energetically demanding for pied flycatchers, Ficedula hypoleuca -- Ward et al. 15 (3): 477 -- ...
		Singing is not energetically demanding for pied flycatchers, Ficedula hypoleuca -- Ward et al.
		Seasonal variation of singing activity and relative effect of the advertising behaviour of males with different plumage colour in the pied flycatcher Ficedula hypoleuca.
		Paternal care in pied flycatchers Ficedula hypoleuca: energy expenditure in relation to plumage colour and mating status.
	beheco.oxfordjournals.org /cgi/content/full/15/3/477 (0 words)

	EFFECTS OF ENVIRONMENTAL CONDITIONS AND PARENTAL QUALITY ON INTER- AND INTRACLUTCH EGG-SIZE VARIATION IN THE COLLARED ... (Site not responding. Last check: 2007-11-02)
		Here we analyzed inter- and intraclutch variation in egg size in the Collared Flycatcher (Ficedula albicollis) on the basis of eight years of data.
		According to our results, mean egg size increased with female condition, but did not differ among young, middle-aged, and old females.
		En este estudio analizamos la variación del tamaño de los huevos entre y dentro de las nidadas en Ficedula albicollis basándonos en datos obtenidos a través de 8 años.
	www.findarticles.com /p/articles/mi_qa3793/is_200504/ai_n13639483 (0 words)

	Centre for the Study of Evolution - University of Sussex (Site not responding. Last check: 2007-11-02)
		Harvey, P. H., Greenwood, P. J., Campbell, B. and Stenning, M. Breeding dispersal of the pied flycatcher (Ficedula hypoleuca).
		Harvey, P. H., Stenning, M. and Campbell, B. Individual variation in seasonal breeding success of pied flycatchers (Ficedula hypoleuca).
		Stenning, M. J., Harvey, P. and Campbell, B. Searching for density-dependent regulation in a population of pied flycatchers, Ficedula hypoleuca Pallas.
	www.biols.susx.ac.uk /cse/members/mstenning/mstenning.htm (0 words)

	birding facts Birding Resources by the Fat Birder
		Egg weight variation in Collared Flycatchers Ficedula albicollis...
		The collared flycatcher — a close relative of the pied flycatcher (F. hypoleuca) — has been the subject of a long-term study (1980 — present) on the Baltic island of Gotland, off the Swedish east coast...
		Acceleration of senescence in the collared flycatcher Ficedula albicollis by reproductive costs...
	www.fatbirder.com /species_and_families/passerines/muscicapidae.html (0 words)

	Contrasting Patterns of Polymorphism and Divergence on the Z Chromosome and Autosomes in Two Ficedula Flycatcher ...
		Contrasting Patterns of Polymorphism and Divergence on the Z Chromosome and Autosomes in Two Ficedula Flycatcher Species -- Borge et al.
		Articles by Borge, T. Articles by Saetre, G.-P. Contrasting Patterns of Polymorphism and Divergence on the Z Chromosome and Autosomes in Two Ficedula Flycatcher Species
		Department of Biology, Centre for Ecological and Evolutionary Synthesis (CEES), University of Oslo, N-0316 Oslo, Norway and
	www.genetics.org /cgi/content/abstract/171/4/1861 (0 words)

	Pied flycatcher - Ficedula hypoleuca - English Nature
		To search for the complete list of plants and/or creatures type a space in the box before you press Search.
		Pied flycatcher - Ficedula hypoleuca - Family: Muscicapidae
		Pied flycatchers favour deciduous woodland in the more hilly areas of NW and SW England, often close to running water.
	www.plantpress.com /wildlife/o71-piedflycatcher.php (0 words)

	Birds: Muscicapidae
		Ficedula hypoleuca (Pallas, 1764) - European Pied Flycatcher
		Ficedula basilanica (Sharpe, 1877) - Little Slaty Flycatcher
		Ficedula disposita (Ripley and Marshall, 1967) - Furtive Flycatcher
	www.phthiraptera.org /Birds/Passeriformes/Muscicapidae.html (0 words)

	Contrasting Patterns of Polymorphism and Divergence on the Z Chromosome and Autosomes in Two Ficedula Flycatcher ...
		The pied flycatcher (Ficedula hypoleuca) and the collared flycatcher
		It is believed that the pied and collared flycatchers and two
		, J., and S., 1991 Male arrival and female mate choice in pied flycatchers (Ficedula hypoleuca) in central Spain.
	www.genetics.org /cgi/content/full/171/4/1861 (0 words)

	Sulawesi and Halmahera \| species \| 6
		The original note about this new species was in Forktail 15, a publication of Oriental Bird Club.
		Rufous-throated Flycatcher Ficedula rufigula: Great views of this skulking flycatcher low down in Lore Lindu NP.
		Blue-fronted Flycatcher Cyornis hoevelli: Some nice looks up at Anaso.
	homepage.mac.com /alanwilkinson/birding/sulawesi/species6.html (0 words)

Try your search on: Qwika (all wikis)