
	Where results make sense

Topic: Heteronetta

Related Topics

Anatidae

Common Scoter

Surf Scoter

Velvet Scoter

Melanitta

Takahe

Lamar, Nebraska

Myxosporea

Plum

Bond Girl

VisualAge

Comic strip

Henrik Lund

Rice burner

Field (mathematics)

	PHYLOGENY AND COMPARATIVE ECOLOGY OF STIFF-TAILED DUCKS (ANATIDAE: OXYURINI)
		Within the tree, Heteronetta is the sister-group of all other Oxyurini; the latter group (supported by 20 unambiguous synapomorphies) comprises two major subgroups--(1)No- monyx and (2) Oxyura + Biziura (Fig.
		All branches in the shortest tree except that uniting Oxyura, exclusive of jamaicensis, were conserved in a majority-rule consensus tree of 1000 boot-strapped replicates.
		Members of the Oxyurini are foot-propelled diving birds (Townsend 1909, Brooks 1945, Tome and Wrubleski 1988) and range in diving ability from the largely surface-feeding Black-headed Duck to the highly specialized Musk Duck (Raikow 1970, 1973; Livezey 1986).
	elibrary.unm.edu /sora/Wilson/v107n02/p0214-p0234.html (10175 words)

	The Scientist :: Ducks in evolution's crossfire, Nov. 22, 2004
		The reason lies in an intraspecific battle being fought within the host species: the parasite is simply caught in the crossfire.
		The fl-headed duck Heteronetta atricapilla, a little-known South American species, is the only obligate brood parasite whose chicks require no more parental care than incubation as eggs: within a day of hatching, they leave the host nest and set off for independent life.
		Despite the apparently minimal costs of parasitism—limited to incubating an extra egg—the two coot species that play host to over 80% of the duck's eggs frequently reject them from their nests.
	www.biomedcentral.com /news/20041122/01 (697 words)

	Rednova NEWS \| Is Homoplasy or Lineage Sorting the Source of Incongruent mtDNA and Nuclear Gene Trees in the ... (Site not responding. Last check: 2007-11-07)
		Livezey (1997) restricted the term "stiff-tailed ducks" (subtribe Oxyurina) to Nomonyx, Oxyura, and Biziura, which along with Heteronetta compose the tribe Oxyurini ("stiff-tailed ducks and allies").
		The overall consistency of characters supporting the three alternative clades was on average slightly lower for the set of characters supporting (O. australis, O. maccoa).
		The ancestral geographic range of Nomonyx-Oxyura probably was lowland South America because most basal stiff-tailed ducks, Nomonyx and O. vittata (and also Heteronetta), are endemic to lowland South America, Central America, or the Caribbean.
	www.rednova.com /modules/news/tools.php?tool=print&id=141487 (8790 words)

	PMA - Eggs - A Virtual Exhibition - Brood Parasitism
		The energy saved by this behaviour can then be used for egg production.
		Here, a clutch of 5 Red-gartered Coot eggs (Fulica armillata) is parasitized by one Black-headed Duck egg, (Heteronetta atricapilla).
		Although a number of different birds practice brood parasitism, two of the best known examples are the New World Cowbirds and the European Cuckoo.
	www.virtualmuseum.ca /Exhibitions/Birds/PMA/vexhome/broodpar.htm (621 words)

	Anseriformes; Ducks, Geese, Swans and Screamers
		Most have highly ritualised courtship though the duration of the pair bond varies greatly, from almost non-existent in the Muscovy Duck, Carina moschata, through one breeding season for many ducks and geese, to lifelong for Swans.
		A few species of duck are polygynous and one species, the Black-headed Duck, Heteronetta atricapilla, is a cuckoo, laying its eggs in the nests of other birds.
		Nests are usually on the ground near water, though a few species nest in holes in trees and one species, the Torrent Duck from the Andes (Merganetta armata), nests in holes in riverbanks.
	www.earthlife.net /birds/anseriformes.html (2618 words)

	Pochards \| Animal Facts \| Chaffee Zoological Gardens of Fresno (Site not responding. Last check: 2007-11-07)
		In surface swimming, the feet are moved independently, while diving the feet push backwards together.
		The rosybill pochard is the nest of choice for the only duck that is an obligate nest parasite, the fl-headed duck Heteronetta atricapilla, of the stiff-tail tribe.
		As would be expected, pochards, even the chicks, escape predators by diving.
	www.chaffeezoo.org /animals/pochards.html (937 words)

	Integrative and Comparative Biology: Molecular genetic perspectives on avian brood parasitism
		In addition, the shared habit of hole-nesting between parasites and hosts may help to explain the evolution of parasitism in this clade (see Eadie et al., 1988).
		The waterfowl (Anatidae), which is distinguished by a high frequency of both inter-specific and conspecific facultative brood parasitism (Eadie et al., 1988; Rohwer and Freeman, 1989; Sorenson, 1992), includes a single obligate brood parasite, the fl-headed duck Heteronetta atricapilla.
		This species represents a relatively recent origin of obligate parasitism and recent molecular analyses suggest it is most closely related to stifftails, Oxyurinae (McCracken et al., 1999), consistent with morphological evidence (Livezey, 1995).
	www.findarticles.com /p/articles/mi_qa4054/is_200204/ai_n9062634/pg_3 (1194 words)

	[No title] (Site not responding. Last check: 2007-11-07)
		The avifauna includes species such as the threatened red-legged seriema Cariama cristata, fl-necked swan Cygnus melanocoryphus, Coscoroba swan Coscoroba coscoroba and muscovy duck Cairina moschata.
		Black-headed duck Heteronetta atricapilla, snowy egrets Egretta thula, white-faced ibis Plegadio chili, fl-winged stilts Himantopus himantopus and brown-hooded gulls Larus maculipennis are all found in the marshes around Merima.
		In addition, this zone is one of the most important in the southern hemisphere for the study of migratory birds such as Pluvialis dominicus, albatross Diomedea melanophys, petrel Daption capensis, Chionis alba and penguins.
	www.unep-wcmc.org /sites/pa/0424q.htm (659 words)

	Heteronetta atricapilla
		Heteronetta atricapilla related books, DVDs, Music at Amazon
		Heteronetta atricapilla related discount products at Discount Hunter
		Integrative and Comparative Biology - Molecular genetic perspectives on avian brood parasitism
	www.articlesgalore.com /documents/Heteronetta_atricapilla (94 words)

	[No title]
		.] Stictonetta CTTTGGGTCACTTCTAGCAATTTGCCTAGCCACACAAATCCTAACAGGCCTCTTACTAGC [60] Biziura CTTCGGATCTCTATTAGCRATCT?YTTAGCCACACAA?TCCTGACAGGCCTACTACTAGC [60] Heteronetta ????????????????????????????????????????????????????????????
		.] Stictonetta CGTACACTACACCGCAGACACTTCCCTCGCATTCTCTGCAGTCGCCCACACATGCCGAGA [120] Biziura CATACACTACACCGCAGATACATCACTTGCCTTCTCCTCAGTTACCCACACATGCCGAGA [120] Heteronetta ????????????????????????????????????????????????????????????
		[1045] Biziura AGAAAACAAAATACTCAACTGCTAA [1045] Heteronetta AGAAAACAAAATACTCAACTGCTAA [1045] jamaicensis AGAAAACAAAA??????????????
	ag.arizona.edu /systbiol/SSBWeb/issues/48_4/McCracken.txt (799 words)

Try your search on: Qwika (all wikis)