Factbites
 Where results make sense
About us   |   Why use us?   |   Reviews   |   PR   |   Contact us  

Topic: Rattus fuscipes


Related Topics
Rat

In the News (Tue 15 Dec 09)

  
  ADW: Rattus lutreolus: Information
Rattus lutreolus prefers poorly drained habitats, heathland, and sedges.
Rattus lutreolus is dark gray or gray brown on its dorsal surfaces and cream to brown on its ventral surface.
"Habitat utilization patterns of sympatric populations of Pseudomys gracilicaudatus and Rattus lutreolus in coastal heathland: A multivariate analysis." Australian Journal of Ecology 20, 427-441.
animaldiversity.ummz.umich.edu /site/accounts/information/Rattus_lutreolus.html   (591 words)

  
 Rat - Facts, Information, and Encyclopedia Reference article
The most well-known species are the Black Rat Rattus rattus, and the Brown Rat Rattus norvegicus.
These are of the species Rattus norvegicus, which originated in the grasslands of China and spread to Europe and eventually, in 1775, to the New World.
The Black Plague is traditionally believed to have been caused by the micro-organism Yersinia pestis, carried by the rat flea Xenopsilia cheopis which preyed on Rattus rattus living in European cities of the day; it is notable that these rats were also victims themselves.
www.startsurfing.com /encyclopedia/r/a/t/Rat.html   (1110 words)

  
 Wildlife of Sydney - Fact File - Bush Rat
A native rat, the Bush Rat is grey-brown in colour with rounded ears and a relatively short tail.
It may sometimes be confused with other rodents seen in Sydney, such as the introduced Black Rat (Rattus rattus) and the Brown Rat (Rattus norvegicus).
The differences are that the Black Rat has a tail longer than its body and is not as shy around humans as the Bush Rat, and the Brown Rat has small ears and a thick tail.
faunanet.gov.au /wos/factfile.cfm?Fact_ID=309   (139 words)

  
 Fire Research Report - 63
Radio tracking of R. fuscipes indicated that it was mainly restricted to dense thickets of sedges, rushes and ferns in gullies.
However, the population recovered in the second year due to a combination of high breeding rate, a significant proportion of the population surviving in the burnt area and the rapid accumulation of leaf litter in which to forage.
Although A. agilis and R. fuscipes have different habitat preferences, the survival and recovery of both species depends largely on retention of unburnt habitat patches.
www.nre.vic.gov.au /DSE/nrenfoe.nsf/LinkView/43ABCE620DCF92D1CA256ECB000103DD7B3EF002FA04DC3A4A256DEA0013F3CB   (492 words)

  
 Rat - Wikipedia, the free encyclopedia   (Site not responding. Last check: 2007-10-09)
The best-known rat species are the Black Rat Rattus rattus and the Brown Rat R.
rattus living in European cities of the day; it is notable that these rats were victims of the plague themselves.
The genus Rattus is a member of the giant subfamily Murinae.
www.knowledgehunter.info /wiki/Rat   (1429 words)

  
 SingaporeMoms - Parenting Encyclopedia - Rat
Descendants of Norwegian rats bred for research, these animals are often called "fancy rats", "coloured rats" or "colour rats." Domesticated rats tend to be both more docile than their wild ancestors and more disease prone, presumably due to inbreeding.
There are over 50 species of rats, the most well-known of which are the Brown Rat, Rattus norvegicus; the Black Rat, Rattus rattus; and the Polynesian Rat, Rattus exulans.
Like mice, rats (especially albino Rattus norvegicus) are frequently subjects of medical, psychological and other biological experiments due to their rapid growth to sexual maturity and because rats are easily kept and bred in captivity.
www.singaporemoms.com /parenting/Rat   (765 words)

  
 CSIRO PUBLISHING - Wildlife Research
Rattus assimilis, R, greyii, and R. fuscipes of southern Australia interbreed readily in captivity with no reduction in viability of either the parental or the hybrid generation.
Their present-day allopatry is presumably of recent origin, and the persistence of close genetic affinity, as reflected in their morphology, behaviour, ecology, and reproductive mechanisms, justifies their conspecific status as members of the single species Rattus fuscipes (Mus fuscipes Waterhouse, 1839).
Rattus lutreolus is clearly a species distinct from R. fuscipes.
www.publish.csiro.au /nid/144/paper/CWR9650101.htm   (106 words)

  
 Berkeley Natural History Museums
Rattus rattus alexandrinus (fl rat) (79) view specimens
Rattus rattus browni (fl rat) (2) view specimens
Rattus rattus rattus (fl rat) (325) view specimens
bnhm.berkeley.edu /browse/vertebrates_Mammalia_Rodentia_Muridae_Rattus_all.php?ViewResults=vertebrates_Mammalia_Rodentia_Muridae_Rattus_all   (309 words)

  
 IngentaConnect Adult free zones in small mammal populations: response of Austral...   (Site not responding. Last check: 2007-10-09)
In this study, we manipulated specific aspects of cover in the eucalypt forests of Fraser Island and show that the behaviour and population dynamics of small mammals were greatly affected.
Rattus fuscipes must trade-off remaining in an environment with increased risk of predation, or disperse to an area with greater cover but increased competition.
While adult R. fuscipes are either killed by predators or disperse to other areas, juveniles that remained or immigrated to an area of reduced cover gained a selective advantage over those in control sites, because reduced competition with adults increased body condition of juvenile R. fuscipes.
www.ingentaconnect.com /content/bsc/aec/2005/00000030/00000008/art00007   (396 words)

  
 Living Harbour - Rodents
One, the Water-rat Hydromys chrysogaster, is a native while the other three, the Black Rat, Rattus rattus, Brown Rat, Rattus norvegicus and House Mouse, Mus domesticus are introduced.
Another native rodent, the Bush Rat, Rattus fuscipes, inhabibits bushland areas to the north and south of Sydney including Ku-ring-gai Chase National Park but no longer occurs in the harbour area.
The Black Rat is probably the most familiar to Sydney residents.
www.livingharbour.net /mammals/rodents.htm   (144 words)

  
 Queensland Museum - Inquiry Centre - Odd Spot - Too Cute
Believe it or not, the cute little furry face peering out of the greenery belongs to a rat, and an introduced Black Rat Rattus rattus at that.
As the photograph implies, Black Rats are quite at home living next to humans: this is clearly evident in other common names applied to Rattus rattus – Roof Rat, House Rat and Ship Rat.
In contrast, Australia's native rats, such as the Swamp Rat Rattus lutreolus, Bush Rat Rattus fuscipes or Pale Field Rat Rattus tunneyi, are shy animals that prefer more natural habitats.
www.qm.qld.gov.au /inquiry/oddspot/2004/rat.asp   (300 words)

  
 NCBI BLAST Search Results
178 4e-42 gi1465760gbU59883MMMLH1E3 Mus musculus MLH1 gene, exon 3 178 4e-42 gi4090427gbU50355RNU50355 Rattus norvegicus neutrophil...
gi5070518gbAF145112.1AF145112 Rattus fuscipes assimilis RT1.Ba gene, RT1.Ba-R5 allele, intron b, partial sequence Length = 429 Score = 188 bits (95), Expect = 4e-45 Identities = 143/156 (91%), Gaps = 1/156 (0%) Strand = Plus / Minus Query: 1716 gcactgactgctcttccaaaggtcctgagttcaaatcccagcaaccacatggtggctcac 1775
gi5070516gbAF145110.1AF145110 Rattus fuscipes coracius RT1.Ba gene, RT1.Ba-R41 allele, intron b, partial sequence Length = 442 Score = 188 bits (95), Expect = 4e-45 Identities = 143/156 (91%), Gaps = 1/156 (0%) Strand = Plus / Minus Query: 1716 gcactgactgctcttccaaaggtcctgagttcaaatcccagcaaccacatggtggctcac 1775
www.sanger.ac.uk /HGP/Chr22/Mouse/Blastn/Em:U20225.dna.blastn.html   (5766 words)

  
 ITIS Standard Report Page: Rattus
Rattus G. Fischer, 1803 -- Old World rats
Rattus norvegicus (Berkenhout, 1769) -- Norway rat, rat surmulot
Rattus rattus (Linnaeus, 1758) -- fl rat, rat noir
www.itis.gov /servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180361   (265 words)

  
 Sodium Fluoroacetate. TOXNET profile from Hazardous Substances Data Bank.
Administration of 300 mg sodium fluoroacetate/kg body weight reduced the oxygen consumption of the skink by between 2.5 and 11% while in the rat, 2 mg sodium fluoroacetate/kg body weight reduced oxygen consumption by between 28 and 57%.
Aconitate hydratase activity in extracts of liver acetone powders from Tiliqua rugosa was less inhibited by (-)erythrofluorocitrate (Ki; 0.065 mM) than that in extracts derived from Rattus norvegicus (Ki; 0.026 mM).
The rate of defluorination of fluoroacetate in erythrocytes and in extracts of liver acetone powders of Tiliqua rugosa was 8- and 4.5-fold greater, respectively, than that found in similar preparations from Rattus norvegicus.
www.flouridealert.com /pesticides/sodium.fluoroacetate.toxnet.htm   (8691 words)

  
 Pandora Archive : Information sheet : the bush rat : rattus fuscipes   (Site not responding. Last check: 2007-10-09)
Pandora Archive : Information sheet : the bush rat : rattus fuscipes
Information sheet : the bush rat : rattus fuscipes
Please send your comments and suggestions about sites archived by the State Library of Victoria to pandora@slv.vic.gov.au
pandora.nla.gov.au /tep/65008   (69 words)

  
 Mammal Names - R
Rat; Greater Stick-nest Leporillus conditor © Tony Robinson
Rattus leucopus Cape York rat © Tony Robinson
Red Fox {not current name} Vulpes vulpes © Peter Menkhorst
www.viridans.com /mampics/rmamm.htm   (240 words)

  
 Project Rainforest - Mammals
Fawn-footed (Melomys ceruinipes) - mosaic-tailed rats with a mosaic-like pattern of scales on their tails
House Mouse (Musmusculus) and the Black Rat (Rattus rattus) - omnivorous
Bats make up over half of the mammals of the rainforests with most of them being fruit eaters.
library.thinkquest.org /26252/explore/11.htm   (563 words)

Try your search on: Qwika (all wikis)

Factbites
  About us   |   Why use us?   |   Reviews   |   Press   |   Contact us  
Copyright © 2005-2007 www.factbites.com Usage implies agreement with terms.