
	Where results make sense

Topic: Satellite DNA

Related Topics

Minisatellite

Microsatellite

Tandem repeats

Chicken

In the News (Sat 12 Dec 09)

Northern Trust

Marvin Harrison

Peter Chernin

Gary Locke

Match Play

Penelope Cruz

Mickey Rourke

AR Rahman

Danny Boyle

Hugh Jackman

	Satellite DNA - Wikipedia, the free encyclopedia
		Satellite DNA consists of highly repetitive DNA, and is so called because repetitive DNA sequences tend to have a relatively high frequency of the nucleotides Adenine and Thymine, and thus have lower density - such that they form a second 'satellite' band when genomic DNA is separated along a density gradient.
		Most satellite DNA is localized to the telomeric or the centromeric region the chromosome.
		Satellite DNA, at least the microsatellite variety, is thought to have originated by slippage of a replicated chromosome against its template.
	en.wikipedia.org /wiki/Satellite_DNA (221 words)

	Junk DNA - Wikipedia, the free encyclopedia
		In molecular biology, "junk" DNA is a collective label for the portions of the DNA sequence of a chromosome or a genome for which no function has yet been identified.
		It is notable that overall genome size, and by extension the amount of junk DNA, appears to have little relationship to organism complexity: the genome of the unicellular Amoeba dubia has been reported to contain more than 200 times the amount of DNA in humans.
		Some proponents of evolution hold (1) that at least some junk DNA is truly nonfunctional and (2) that this is evidence for common descent, since the hierarchy of nonfunctional genetic similarities mimics the phylogenetic tree.
	en.wikipedia.org /wiki/Junk_DNA (1328 words)

	Genetics Glossary S (Site not responding. Last check: 2007-11-04)
		DNA that forms a separate band in a bouyant density gradient because of its different nucleotide composition (A:T rich DNAs are less dense than G:C rich DNAs).
		The central framework of a chromosome to which the DNA solenoid is attached as loops; composed largely of topoisomerase.
		The RecA protein, stimulated by single-stranded DNA, is involved in the inactivation of the LexA repressor thereby inducing the response.
	helios.bto.ed.ac.uk /bto/glossary/s.htm (3039 words)

	Evaluation of intra- and interspecific divergence of satellite DNA sequences by nucleotide frequency calculation and ...
		Satellite DNA sequences are known to be highly variable and to have been subjected to concerted evolution that homogenizes member sequences within species.
		We have analyzed the mode of evolution of satellite DNA sequences in four fishes from the genus Diplodus by calculating the nucleotide frequency of the sequence array and the phylogenetic distances between member sequences.
		Although some centromeric satellite DNA is known to participate in the construction of functional centromeres (2-6), their nucleotide sequences are highly variable.
	www.biologicalprocedures.com /bpo/arts/1/47/m47.htm (2587 words)

	American Zoologist: Toward an understanding of satellite DNA function in crustacea
		The diversity of transcripts suggests that transcription of the satellite is related to the organization of the repeated DNA in the crab genome, and that some satellite domains may be transcribed because of their position relative to functional genes.
		DNA methylation patterns are also tissue-specific; of the seven tissues examined (gill, claw muscle, body muscle, limb buds, midgut gland, testis, and ovary), gill stDNA is the least methylated.
		The satellite is composed of repeat units of 2.1 kbp which have been defined by cutting the satellite DNA with the restriction enzyme EcoRI (Graham and Skinner, 1973; Holland and Skinner, 1977; LaMarca et al., 1981; Skinner et al., 1982).
	www.findarticles.com /p/articles/mi_qa3746/is_199906/ai_n8829399 (1427 words)

	Highly Repeated DNA (Site not responding. Last check: 2007-11-04)
		Sheared nuclear DNA of Drosophila melanogaster was analyzed by isopycnic centrifugation in CsCl.
		Satellite DNAs are usually in heterochromatic regions of the chromosomes, often around centromeres and near telomeres.
		The satellite DNAs belong to the highly repetitive kinetic class of DNA sequences.
	opbs.okstate.edu /~melcher/MG/MGW1/MG112284.html (366 words)

	Severe leaf curl disease, cowpea - India (Site not responding. Last check: 2007-11-04)
		Satellite DNA b was amplified with universal DNA b primers b01/ b02 (Briddon et al, 2003) and the ca.1.3 kb amplicon was cloned and sequenced (Accession No. AY728263).
		Thus, the pathogenicity of the virus is increased by the presence of satellite DNA b.
		This is the 1st report of a satellite DNA b associated with a bipartite begomovirus infecting a leguminous host.
	laurel.nal.usda.gov /agnic/pmp/2004/slc111904.html (918 words)

	Molecular Cytogenetics and Genome Organization - Pat Heslop-Harrison
		All three satellite DNA families were present at the centromeres of the many but not all of the autosomal acrocentric chromosomes, and essentially absent from the sex chromosomes.
		Satellite I and a newly isolated satellite II clones were used to characterize the centromeric regions of both the novel and the three pairs of evolutionarily-derived biarmed chromosomes.
		Genomic DNA was analysed using methylation-sensitive restriction enzymes and, as probes, two rDNA sequences, two tandemly organised DNA sequences from rye (pSc200 and pSc250), and copia and the gypsy group retrotransposon fragments from rye and wheat.
	www.le.ac.uk /biology/phh4/titleabst.htm (13149 words)

	[No title]
		During the early development of DNA sequence analysis, genomic DNA was used as a species-specific probe and was hybridised to DNA extracted from meat samples [1, 7, 9, 26].
		An alternative DNA detection system is based on the polymerase chain reaction (PCR) amplification of a segment of the mitochondrial cytochrome b gene [15, 18, 23, 24, 27].
		DNA can be extracted from meat samples by using one of three methods: rapid alkaline lysis (Protocol 1), a similar procedure to Protocol 1 but with extra purification steps (Protocol 2), the common proteinase K/sodium dodecyl sulphate (SDS) procedure (Protocol 4).
	www.vetscite.org /publish/articles/000012/article.html (4187 words)

	DNA fingerprinting (Site not responding. Last check: 2007-11-04)
		Type a and b DNA samples are often very similar between species such as sheep and cows (since similar genes and proteins are needed in each).
		Satellite DNA (type c) is often very different between species.
		Satellite DNA cut with a restriction enzyme will result in many fragments of the same size.
	www.susqu.edu /FacStaff/r/richard/DNAfgnrprnt.html (324 words)

	Structural Changes Induced by Binding of the High-Mobility Group I Protein to a Mouse Satellite DNA Sequence -- ... (Site not responding. Last check: 2007-11-04)
		on the induction or reversal of DNA bends by HMG-I/Y and on the
		Identification of sequence elements contributing to the intrinsic curvature of the mouse satellite DNA repeat.
		Reversal of intrinsic DNA bends in the IFN
	www.biophysj.org /cgi/content/full/78/5/2543 (8407 words)

	Tandemly Repeated (Satellite) DNA (Site not responding. Last check: 2007-11-04)
		Indeed, a substantial fraction of the genomes of many eukaryotes is composed of repetitive DNA in which short sequences are tandemly repeated in small to huge arrays.
		In general, satellite DNAs show exceptional variability among individuals, particularly with regard to the number of repeats at a given locus.
		Minisatellite loci are the most highly polymorphic sequence elements yet discovered in the human genome, and delineating the repeat lengths of these loci is the basis of most DNA typing systems used in forensic medicine.
	arbl.cvmbs.colostate.edu /hbooks/genetics/medgen/dnatesting/satellites.html (309 words)

	Satellite DNA From the Y Chromosome of the Malaria Vector Anopheles gambiae -- Krzywinski et al. 169 (1): 185 -- ... (Site not responding. Last check: 2007-11-04)
		Satellite DNA From the Y Chromosome of the Malaria Vector Anopheles gambiae -- Krzywinski et al.
		Articles by Krzywinski, J. Articles by Besansky, N. Satellite DNA From the Y Chromosome of the Malaria Vector Anopheles gambiae
		Satellite DNA is an enigmatic component of genomic DNA with
	www.genetics.org /cgi/content/abstract/169/1/185 (230 words)

	satellite DNA - BioInformatics Glossary (Site not responding. Last check: 2007-11-04)
		Repetitive DNA that forms a satellite band in a density gradient.
		Satellite DNA contains a short sequence of nucleotides (5 - 200 bp) which is tandemly repeated hundreds or thousands of times.
		A DNA sequence that is repeated two or more times in a DNA molecule or genome.
	big.mcw.edu /display.php/1403.html (58 words)

	Distinctive higher-order chromatin structure at mammalian centromeres -- Gilbert and Allan 98 (21): 11949 -- ... (Site not responding. Last check: 2007-11-04)
		DNA from individual sucrose gradient fractions was purified by digestion with proteinase K (100 µg/ml) in the presence of
		The probes used were mouse minor satellite R198 (16), mouse major satellite (17), and a B2 interspersed repeat (18).
		The size of the DNA contained in each gradient fraction was determined from densitometer traces of lanes from the ethidium bromide-stained gel and from the phosphorimages of hybridized filters, by reference to DNA size markers (e, for example).
	www.pnas.org /cgi/content/full/98/21/11949 (3756 words)

	Cloning a DNA Segment
		In this program, students use recombinant DNA techniques to clone this satellite DNA and then characterize the sequence by restriction enzyme mapping anaylsis.
		Students digest sheep DNA with EcoR1 and electrophorese the DNA fragments on an agarose gel in order to seperate the satellite DNA from the remaining sequences in the sheep genome.
		The satellite DNA band is eluted from the gel and ligated to EcoR1-digested pUC18 in order to create a recombinant plasmid that contains the satellite sequence.
	www.modernbio.com /cloning_a_dna_segment.htm (290 words)

	DNA Testing (Site not responding. Last check: 2007-11-04)
		Finally, the 1980's ushered in the age of DNA testing, which permits investigators to perform almost unbelieveable feats of identification.
		DNA profiles are widely used in resolving issues of parentage in man and animals, and are rapidly replacing serologic analysis (i.e.
		Additionally, DNA testing is an indispensible tool for positional cloning, a technique by which a previously unknown gene is identified by finding associations or links between DNA markers and the inheritance of a disease.
	arbl.cvmbs.colostate.edu /hbooks/genetics/medgen/dnatesting (248 words)

	Satellite_DNA
		Satellite DNA (blocks often from 100 kb to several Mb in length)
		Satellite DNA is not transcribed and accounts for the bulk of the heterochromatic regions of the genome, being notably found in the vicinity of the centromeres (SR 7-14)(
		Cloned a -satellite arrays have been shown to seed de novo centromeres in human cells, indicating that a -satellite plays an important role in centromere function.
	www.fmv.ulg.ac.be /genmol/MODGEN/Satellite_DNA.htm (121 words)

	PAG-IX: SATELLITE DNA IDENTIFIES HYBRID NATURE OF THE TAIWANESE RED TILAPIA (Site not responding. Last check: 2007-11-04)
		Digestion of genomic DNA isolated from blood samples of both male and female pink tilapia with restriction endonuclease EcoRI revealed two bands.
		Interestingly the satellite DNA fragments when used as a probe to hybridize genomic DNA digested with Hae III enzyme reveal individual specific DNA fingerprinting pattern only in tilapia species.
		Semi quantitative analysis on these fragment of inbred pink tilapia revealed that the 214 bp fragment is only about 1/6 to that of the 245 bp fragment, whereas the out bred individuals this ratio varies indicating various degrees of introgression.
	www.intl-pag.org /pag/9/abstracts/P5o_14.html (253 words)

	Satellite DNA definition - Medical Dictionary definitions of popular medical terms
		Satellite DNA definition - Medical Dictionary definitions of popular medical terms
		Satellite DNA: DNA that contains many tandem (not inverted) repeats of a short basic repeating unit.
		Satellite DNA is located at very specific spots in the genome (on chromosomes 1, 9, 16 and the Y chromosome, the tiny short arms of chromosomes 13-15 and 21 and 22, and near the centromeres of chromosomes).
	www.medterms.com /script/main/art.asp?articlekey=5411 (178 words)

	CENP-C binds the alpha-satellite DNA in vivo at specific centromere domains -- Politi et al. 115 (11): 2317 -- Journal ... (Site not responding. Last check: 2007-11-04)
		Alpha-satellite DNA was revealed by hybridizing the filter with probes specific for alpha-satellite of chromosomes 7, 13 and 21.
		with a mixture of the pZ7.6.B and pZ21.A alpha-satellite DNA
		The analysis of the DNA profile was performed as described in Fig.
	jcs.biologists.org /cgi/content/full/115/11/2317 (7285 words)

	DDP1, a Heterochromatin-Associated Multi-KH-Domain Protein of Drosophila melanogaster, Interacts Specifically with ... (Site not responding. Last check: 2007-11-04)
		The binding of DDP1 to the dodeca-satellite C strand is highly sensitive to the extent of secondary structure of the DNA fragments.
		DNA and RNA sequences (10, 12, 17, 37).
		The position of the free DNA probe is indicated by zero.
	mcb.asm.org /cgi/content/full/20/11/3860 (5057 words)

	Alpha Satellite DNA: Fast Intrachromosomal Conversion Mechanism (Site not responding. Last check: 2007-11-04)
		A section of two 0.17 kb sized alpha satellite monomers derived from random 2 kb higher order repeat subclones of 5 unmapped PACs from a single DXZ1 alpha satellite array of a human X chromosome.
		Abundant variants were used to evaluate the relative impact of genomic turnover mechanisms on the maintenance and evolution of alpha satellite arrays.
		"Satellite tartans" display variation at a glance and will assist in interpreting contiguous sequences of tandem repeat arrays.
	www.tobias-schwarz.net /genome_research.html (336 words)

	Satellite DNA From the Y Chromosome of the Malaria Vector Anopheles gambiae -- Krzywinski et al. 169 (1): 185 -- ... (Site not responding. Last check: 2007-11-04)
		Bands corresponding to monomers and dimers of the AgX367 and AgY477 satellite DNAs are marked with arrows and their respective sizes are given.
		Satellite junctions and discovery of the AgY373 satellite:
		Satellite DNA has remained essentially uncharacterized in mosquitoes.
	www.genetics.org /cgi/content/full/169/1/185 (5174 words)

	An Algorithmic Analysis of the Role of Unequal Crossover in Alpha Satellite DNA Evolution (Site not responding. Last check: 2007-11-04)
		Human DNA consists of a large number of tandem repeat sequences.
		Such sequences are usually called satellites, with the primary example being the centromeric alpha-satellite DNA.
		The basic repeat unit of the alpha-satellite DNA is a 171bp monomer.
	www.jsbi.org /journal/GIW02/GIW02F010.html (119 words)

	Transcription factor YY1 associates with pericentromeric {gamma}-satellite DNA in cycling but not in quiescent (G0) ... (Site not responding. Last check: 2007-11-04)
		DNA sequences consisting primarily of tandem repetitive satellite
		Drosophila DNA binding PcG protein PHO is a homolog of YY1 (10).
		DNA observed in cycling cells is diminished in quiescent (G
	nar.oxfordjournals.org /cgi/content/full/32/14/4390 (4263 words)

	Schistosome Satellite DNA Encodes Active Hammerhead Ribozymes -- Ferbeyre et al. 18 (7): 3880 -- Molecular and Cellular ... (Site not responding. Last check: 2007-11-04)
		to amplify Schistosomatium douthitti satellite DNA, is 5'TATAGGTTTTAGTGTCATTG3'.
		In lane 3, a mixture of both female and male RNA preparations was subjected to the same treatments as were the preparations in lanes 1 and 2, except that reverse transcriptase was omitted.
		Transcription of a satellite DNA in the newt.
	mcb.asm.org /cgi/content/full/18/7/3880 (6021 words)

	De Novo Evolution of Satellite DNA on the Rye B Chromosome -- Langdon et al. 154 (2): 869 -- Genetics (Site not responding. Last check: 2007-11-04)
		De Novo Evolution of Satellite DNA on the Rye B Chromosome -- Langdon et al.
		De Novo Evolution of Satellite DNA on the Rye B Chromosome
		The cloned DNA is 3984 bp long (Figure 4).
	www.genetics.org /cgi/content/full/154/2/869 (8062 words)

	Novel generation of human satellite DNA-based artificial chromosomes in mammalian cells -- Csonka et al. 113 (18): 3207 ... (Site not responding. Last check: 2007-11-04)
		Novel generation of human satellite DNA-based artificial chromosomes in mammalian cells -- Csonka et al.
		DNA, rDNA, and exogenous DNA sequences were heterochromatic, however, they
		The chAB4 and NF1-related long-range multisequence DNA families are contiguous in the centromeric heterochromatin of several human chromosomes
	jcs.biologists.org /cgi/content/abstract/113/18/3207 (438 words)

	Search: Satellite - Info.com (Site not responding. Last check: 2007-11-04)
		Satellite Images such as infrared and water vapor.
		Real-time satellite, ISS, and Space Shuttle orbital pass information, maps, and star charts.
		satellite TV and radio channels worldwide in the Ku, C and S bands.
	www.info.com /Satellite (251 words)

Try your search on: Qwika (all wikis)