Factbites
 Where results make sense
About us   |   Why use us?   |   Reviews   |   PR   |   Contact us  

Topic: Verrucomicrobia


Related Topics

In the News (Mon 6 Jul 09)

  
  Verrucomicrobia - Wikipedia, the free encyclopedia
Verrucomicrobia is a recently described phylum of bacteria.
This phylum contains only a described species (Verrucomicrobia spinosum, is an example, the phylum is named after this).
Evidence suggests that verrucomicrobia are abundant within the environment, and important (especially to soil cultures).
en.wikipedia.org /wiki/Verrucomicrobia   (164 words)

  
 Verrucomicrobia Not yet validly described DG1235 - Microbial Genome Sequencing Project - Gordon and Betty Moore ...
It is apparent that members of the Verrucomicrobia are potentially globally important microbes in biogeochemical cycling, but due to their recalcitrance to culture, very little is known about their physiology, metabolism and ultimately their ecological role.
Ribosomal RNA gene sequence data indicated that isolate DG1235 was a deeply divergent member of the family Opitutaceae (subdivision 4) of the phylum Verrucomicrobia.
DG1235 is proposed for whole-genome sequencing as it is one of very few cultivable pelagic Verrucomicrobia, and its relative dominance within the bacterial community associated with a pelagic microalgae could allude to a potential role in marine ecosystems.
www.moore.org /microgenome/detail.aspx?id=120   (390 words)

  
 Detection of Verrucomicrobia in a Pasture Soil by PCR-Mediated Amplification of 16S rRNA Genes -- O'Farrell and Janssen ...
Verrucomicrobia in DNA extracted from a pasture soil.
of Verrucomicrobia to estimate the numerical abundance of this
RNA of the cloned fragment DA101 (6), have suggested that verrucomicrobia
aem.asm.org /cgi/content/full/65/9/4280   (3093 words)

  
 Detection and Cultivation of Soil Verrucomicrobia -- Sangwan et al. 71 (12): 8402 -- Applied and Environmental ...
of the phylum Verrucomicrobia in the Ellinbank soil was assessed
Cyclic AMP and acyl homoserine lactones increase the cultivation efficiency of heterotrophic bacteria from the central Baltic Sea.
Characterization and identification of numerically abundant culturable bacteria from the anoxic bulk soil of rice paddy microcosms.
aem.asm.org /cgi/content/full/71/12/8402   (5212 words)

  
 Research Highlights
Twenty seven distinct cultivated strains belong to 15 families within the a-, g- and e-Proteobacteria, Firmicutes, Bacteroidetes, and the Green sulfur bacteria.
Forty four phylogenetically distinct bacterial strains were isolated, for which preliminary day suggest eighteen are potentially new species or genera.
Divisions with rarely cultivated or non-cultivated strains include the Chlamydiae, Planctomycetes, Verrucomicrobia and Candidate division TM7.
www.hawaii.edu /microbiology/MO/highlights2.htm   (628 words)

  
 Verrucomicrobia Bacteria
Akkermansia }} Verrucomicrobia is a recently described phylum of bacteria.
The species identified have been isolated from fresh waterand soilenvironments and human feces.
A number of as-yet uncultivated species have been identified in association with eukaryotic hosts including extrusive explosive ectosymbionts of protists and endosymbionts of nematodes residing in their gametes.
www.lumrix.com /medical/bacteria/verrucomicrobia.html   (128 words)

  
 [No title]
02100100000000.21_0g12d26p38t_1seqs Environmental_clone_wchb1-41_subgroup Verrucomicrobia clone LD1-PB9 02100100000000.24_0g4d22p26t_1seqs Environmental_clone_wchb1-41_subgroup Verrucomicrobia clone LD1-PB3 02100100000000.253_24g31d0p55t_1seqs Environmental_clone_wchb1-41_subgroup Verrucomicrobia MERTZ_2CM_283 02100100000000.361_20g23d0p43t_1seqs Environmental_clone_wchb1-41_subgroup clone KS52 02100100000000.40_0g12d18p30t_1seqs Environmental_clone_wchb1-41_subgroup verrucomicrobium DEV055 clone DEV055 02100100000000.427_28g25d0p53t_1seqs Environmental_clone_wchb1-41_subgroup equine intestinal clone:YT6 02100100000000.446_4g6d17p27t_2seqs Environmental_clone_wchb1-41_subgroup Verrucomicrobia clone LD1-PA34 02100100000000.469_26g16d0p42t_1seqs Environmental_clone_wchb1-41_subgroup clone Car98rb 02100100000000.486_1g39d0p40t_1seqs Environmental_clone_wchb1-41_subgroup verrucomicrobium DEV045 clone DEV045 02100100000000.491_26g26d0p52t_1seqs Environmental_clone_wchb1-41_subgroup clone WCHA1-33.
02100100000000.615_24g23d0p47t_1seqs Environmental_clone_wchb1-41_subgroup Verrucomicrobia MERTZ_2CM_235 02100100000000.629_0g6d21p27t_1seqs Environmental_clone_wchb1-41_subgroup Verrucomicrobia clone LD1-PA50 02100100000000.686_0g2d10p12t_1seqs Environmental_clone_wchb1-41_subgroup a2b018 02100100000000.692_26g25d0p51t_1seqs Environmental_clone_wchb1-41_subgroup verrucomicrobiales Sva0585 02100100000000.760_0g0d21p21t_3seqs Environmental_clone_wchb1-41_subgroup Verrucomicrobia clone ML1228J-2 02100100000000.806_0g2d19p21t_4seqs Environmental_clone_wchb1-41_subgroup Verrucomicrobia clone R103-B35 02100100000000.885_0g2d23p25t_1seqs Environmental_clone_wchb1-41_subgroup soil PBS-III-26 02100100000000.985_18g26d0p44t_1seqs Environmental_clone_wchb1-41_subgroup soil PBS-III-20 02100200000000.1025_9g8d0p17t_10seqs Ver.sp_str_veglc2_subgroup str.
02100300000000.660_28g11d0p39t_2seqs Environmental_clone_opb35_subgroup Verrucomicrobia EV134 02100300000000.712_0g0d18p18t_1seqs Environmental_clone_opb35_subgroup clone FW4 02100300000000.772_0g18d16p34t_1seqs Environmental_clone_opb35_subgroup Verrucomicrobia clone VC12 02100300000000.820_10g16d10p36t_1seqs Environmental_clone_opb35_subgroup verrucomicrobium DEV020 clone DEV020 02100400000000.1000_25g12d0p37t_1seqs Prsb.dejongeii_subgroup verrucomicrobium DEV010 clone DEV010 02100400000000.1062_23g17d0p40t_1seqs Prsb.dejongeii_subgroup clone HstpL102.
bbrp.llnl.gov /16S_cgi/download/G2/Mar_12_2004_rep_orgs.txt   (5388 words)

  
 Why Sequence Five Verrucomicrobia?
Isolates of the bacterial phylum Verrucomicrobia have in common that they are specialized to the utilization of sugars.
Their abundance and activity in a large variety of aquatic and terrestrial ecosystems, as well as in the intestine of vertebrates, indicates that this until recently unknown group of microorganisms plays a major role in the global carbon cycle.
The group is an excellent example of bacteria that are hardly detected by culturing but frequently found in 16S rRNA gene libraries from a wide variety of ecosystems, including aquatic and terrestrial environments as well as the mammalian gastrointestinal tract.
www.jgi.doe.gov /sequencing/why/CSP2006/Verrucomicrobia.html   (318 words)

  
 Microbe Magazine
Now Bradley S. Stevenson and John Breznak of Michigan State University (MSU), East Lansing, and their collaborators report success in growing previously uncultivated members of the divisions Acidobacteria and Verrucomicrobia from agricultural soil and from the guts of wood-feeding termites--amid as many as 1,000 colonies of nontarget microbes on the same agar plates.
Group-specific PCR primers were used to detect Acidobacteria and Verrucomicrobia within such mixtures.
            Knowing that Acidobacteria and Verrucomicrobia were present, the MSU researchers then divided each plate into 20-50 sections to pick representative colonies.
www.asm.org /microbe/index.asp?bid=30675   (660 words)

  
 Plotting DE values   (Site not responding. Last check: 2007-10-10)
Generated DE values, are plotted against corresponding mean percentage difference values as a means of highlighting potential anomalous sequences within the supplied sequence data.
For example, analysing sequences derived from members of the Verrucomicrobia, results in the plot shown in Fig.
Analysis of Verrucomicrobia 16S rRNA gene sequences, as downloaded from the Ribosomal Database Project-II (RDP) website.
www.cf.ac.uk /biosi/research/biosoft/Help/Topics/plot.html   (252 words)

  
 [No title]
1543 02100100000000.615_24g23d0p47t_1seqs Environmental_clone_wchb1-41_subgroup Verrucomicrobia MERTZ_2CM_235 39740 02100100000000.629_0g6d21p27t_1seqs Environmental_clone_wchb1-41_subgroup Verrucomicrobia clone LD1-PA50 70013 02100100000000.686_0g2d10p12t_1seqs Environmental_clone_wchb1-41_subgroup a2b018 70602 02100100000000.692_26g25d0p51t_1seqs Environmental_clone_wchb1-41_subgroup verrucomicrobiales Sva0585 37080 02100100000000.760_0g0d21p21t_3seqs Environmental_clone_wchb1-41_subgroup Verrucomicrobia clone ML1228J-2 63828 02100100000000.806_0g2d19p21t_4seqs Environmental_clone_wchb1-41_subgroup Verrucomicrobia clone R103-B35 61852 02100100000000.885_0g2d23p25t_1seqs Environmental_clone_wchb1-41_subgroup soil PBS-III-26 69582 02100100000000.985_18g26d0p44t_1seqs Environmental_clone_wchb1-41_subgroup soil PBS-III-20 37973 02100200000000.1025_9g8d0p17t_10seqs Ver.sp_str_veglc2_subgroup str.
1559 02100200000000.103_26g7d0p33t_1seqs Ver.sp_str_veglc2_subgroup Rhizosphere soil clone RSC-II-64 39216 02100200000000.110_28g21d0p49t_1seqs Ver.sp_str_veglc2_subgroup Verrucomicrobia MERTZ_2CM_57 33333 02100200000000.29_0g22d2p24t_6seqs Fucophilus fucoidanolyticus 41135 02100200000000.433_0g2d18p20t_1seqs Ver.sp_str_veglc2_subgroup clone RCP2-6 63314 02100200000000.554_26g26d0p52t_1seqs Ver.sp_str_veglc2_subgroup clone EKHO-20.
1587 02100300000000.660_28g11d0p39t_2seqs Environmental_clone_opb35_subgroup Verrucomicrobia EV134 26596 02100300000000.712_0g0d18p18t_1seqs Environmental_clone_opb35_subgroup clone FW4 63232 02100300000000.772_0g18d16p34t_1seqs Environmental_clone_opb35_subgroup Verrucomicrobia clone VC12 81873 02100300000000.820_10g16d10p36t_1seqs Environmental_clone_opb35_subgroup verrucomicrobium DEV020 clone DEV020 31253 02100400000000.1000_25g12d0p37t_1seqs Prsb.dejongeii_subgroup verrucomicrobium DEV010 clone DEV010 35295 02100400000000.1062_23g17d0p40t_1seqs Prsb.dejongeii_subgroup clone HstpL102.
bbrp.llnl.gov /16S_cgi/download/G2/Mar_12_2004_rep_orgs_with_ids.txt   (6104 words)

  
 Response of a member of the Verrucomicrobia, among the dominating bacteria in a hypolimnion, to increased phosphorus ...
Response of a member of the Verrucomicrobia, among the dominating bacteria in a hypolimnion, to increased phosphorus availability -- Lindström et al.
Response of a member of the Verrucomicrobia, among the dominating bacteria in a hypolimnion, to increased phosphorus availability
this particular Verrucomicrobia was favoured by increased phosphorus
plankt.oxfordjournals.org /cgi/content/abstract/26/2/241   (305 words)

  
 Faculty - John Breznak, Ph.D.
Tom Schmidt to tap into the as-yet-untapped microbial diversity in soils.
Of particular interest to us are novel bacteria whose presence and abundance has been inferred from 16S rDNA sequences retrieved from soil, but which themselves are not-yet-cultured or poorly represented in culture, e.g members of the "Verrucomicrobia", "Acidobacteria" and "Planctomyces" groups.
Apparently, traditional cultivation techniques have been inadequate to isolate such organisms.
www.msu.edu /unit/mic/faculty/breznak.htm   (466 words)

  
 Genes for the cytoskeletal protein tubulin in the bacterial genus Prosthecobacter -- Jenkins et al. 99 (26): 17049 -- ...
of the division Verrucomicrobia to be subjected to genome-sequencing
transfer from an ancestor of the Verrucomicrobia to a protoeukaryotic
occurred between members of the Verrucomicrobia and eukaryotes.
www.pnas.org /cgi/content/full/99/26/17049   (3102 words)

  
 Prosthecobacter - MicrobeWiki
It has been hypothesized that BtubA and BtubB were transferred to Prosthecobacter from eukaryotic cells through horizontal gene transfer.
"The Phylum Verrucomicrobia: A Phylogenetically Heterogeneous Bacterial Group."
"The Phylum Verrucomicrobia: A Phylogenetically Heterogeneous Bacterial Group." The Prokaryotes.
microbewiki.kenyon.edu /index.php/Prosthecobacter   (344 words)

  
 Lakes Laysan Observations
Cloned representatives of the Bacteroidetes included one OTU that affiliated with obligate psychrophiles (Psychroflexus spp., Family Flavobacteriaceae) from Antarctic sea-ice.
The b-Proteobacteria, Chloroflexi, Deinococci and Verrucomicrobia were each represented by just one OTU (Table 1).
Forty-two pure bacterial cultures derived from Lake Laysan.
www.hawaii.edu /microbiology/MO/laysan2.htm   (489 words)

  
 Microbial diversity in marine sediments from Sagami Bay and Tokyo Bay, Japan, as determined by 16S rRNA gene analysis ...
Phylogenetic tree of the Gram-positive bacteria and Verrucomicrobia.
, the Verrucomicrobia and the three subclasses of the
Hedlund, B. P., Gosink, J. and Staley, J. Verrucomicrobia div.
mic.sgmjournals.org /cgi/content/full/145/11/3305   (4562 words)

  
 [No title]
Uncultured Verrucomicrobia bacterium clone BAC-P109-1F 16S ribosomal RNA gene, partial sequence CCGAAATCAAAGGTGGCGCAAGCTACCGCTTTTTGAGGGGCCCGCGGCCTATCAGCTTGTTGGTGAGGNA ACGGCTCACCAAGGCTANGACGGGTAGCTGGTCTGAGAGGACGACCAGTCACACTGNGACTGANACACGG CCCAGACACCTACGGGTGGCAGCAGTCGAGAATTTTTGACAATGGGGGAAACCCTGATCGAGCGACGCCG CGTGGAGGATGAAGGTCTTCGGGTTGTAAACTCCTGTCATTTGGGAACAAGGCGCACGTATTAACTGTGC GTGCGTTGATAGTACCAGAAGAGGAAGAGACGGCTAACTCTGTGCCAGCAGCCGCGGTNATACAGAGGTC TCAAGCGTNGTTNGGATTCATTGGGCGTAAAGGGTGTGT >gi29468949gbAY214910.1
Uncultured Verrucomicrobia bacterium clone BAC-P37-1A 16S ribosomal RNA gene, partial sequence AAAGAGTCTTTTGGCGAACGGGTGCGTAACACGTGGGCAATCTGCCTTAAAGTGGGGGATAGCTCGGCGA AAGCCGAATTAATACCGCATGTGATCAGGGGAGACATCTTCCCGAAATCAAAAGTGGCGCAAGCTACTGC TTTTTGAGGAGCCCGCGGCCTATCAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCTTTGACGGGTAGCT GGTCTGAGAGGACGACCAGTCACACTGGAACTGAGACACGGTCCAGACACCTACGGGTGGCAGCAGTCGA GAATTTTTCTCAATGGGGGCAACCCTGAAGGAGCGACGCCGCGTGGAGGATGAAGGTCTTCGGGTTGTAA ACTCCTGTCATTTGGGAACAAGTGTCGGTACGTAACTGCTACCGGCTTGATAGTACCAGAAGAGGAAGAG ACGGCTAACTCTGTGCCAGCAGCCGCGGT >gi29468948gbAY214909.1
Uncultured Verrucomicrobia bacterium clone BB-2-F3R 16S ribosomal RNA gene, partial sequence CCTTCATCCTCCACGCGGCGTCGCTCGATCAGGGTTTCCCCCATTGTCAAAAAGTCTCGACTGCTGCCAC CCGTAGGTGTCTGGACCGTGTCTCGGTTCCAGTGTGACTGGTCGTCCTCTCAGACCAGCTACCCGTCAAA GCCTTGGTGAGCCGNTACCTCACCAACAAGCTGATAGGCCGCGGGCTCCTCAAAAAGCGCCAGGTTGCCC CGGCTTTAATTTCGGGTAGATGTCTTCCCTAATCACATGCGGTATTAATTCGGCTTTCGCCGAGCTATCC CCCACTTTAAGACAGATTGCCCACGTGTTACGCACCCGTTCGCCGCTAGATTTCTTTTTGTATTGCTACA GAAAGAAATCTCGCTCGACTTGCATGTCTTATCCACGCCGCAGCGTTCGTTCTGAGCCATGATCAAACTC T >gi29468841gbAY214802.1
www.plantpath.wisc.edu /goodman/addinfo/SL2_seqs_fasta.htm   (4417 words)

  
 [No title]   (Site not responding. Last check: 2007-10-10)
SOURCE uncultured Verrucomicrobia bacterium ORGANISM uncultured Verrucomicrobia bacterium Bacteria; Verrucomicrobia; environmental samples.
69 (5), 2684-2691 (2003) PUBMED 12732537 REFERENCE 2 (bases 1 to 481) AUTHORS Liles,M.R., Bintrim,S.B., Manske,B.F., Handelsman,J. and Goodman,R.M. TITLE Direct Submission JOURNAL Submitted (09-JAN-2003) Plant Pathology, University of Wisconsin, Room 694, Russell Laboratories, 1630 Linden Drive, Madison, WI 53706, USA FEATURES Location/Qualifiers source 1..481 /organism="uncultured Verrucomicrobia bacterium" /mol_type="genomic DNA" /isolation_source="soil" /db_xref="taxon:156588" /clone="BAC-P85-2H" /environmental_sample rRNA
69 (5), 2684-2691 (2003) PUBMED 12732537 REFERENCE 2 (bases 1 to 389) AUTHORS Liles,M.R., Bintrim,S.B., Manske,B.F., Handelsman,J. and Goodman,R.M. TITLE Direct Submission JOURNAL Submitted (09-JAN-2003) Plant Pathology, University of Wisconsin, Room 694, Russell Laboratories, 1630 Linden Drive, Madison, WI 53706, USA FEATURES Location/Qualifiers source 1..389 /organism="uncultured Verrucomicrobia bacterium" /mol_type="genomic DNA" /isolation_source="soil" /db_xref="taxon:156588" /clone="BAC-P109-1F" /environmental_sample rRNA
www.plantpath.wisc.edu /goodman/addinfo/SL2_seqs_genbank.txt   (3497 words)

Try your search on: Qwika (all wikis)

Factbites
  About us   |   Why use us?   |   Reviews   |   Press   |   Contact us  
Copyright © 2005-2007 www.factbites.com Usage implies agreement with terms.